EMAIL THIS PAGE TO A FRIEND

LILRA2

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2

23 Gene Product Result for
Synonyms: CD85H ILT1 LIR-7 LIR7
Species: Human LILRA2(11027)
UniProtKB ID: Q8N149, O75020
Gene ID:
Human(11027) Summary: This gene encodes a member of the leukocyte Ig-like receptor (LIR) family of immunoreceptors that are expressed predominantly on monocytes and B cells, and at lower levels on dendritic cells and natural killer cells. The LIR family comprises of activating (subfamily A) and inhibitory (subfamily B) cell-surface receptors. The LIR encoded by this gene was shown to be an activating receptor for eosinophils that elicited the release of cytotoxic granule proteins, de novo lipid mediator generation, and cytokine release through vesicular transport. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006866 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006866 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206852 predicted 280
2 SASI_Hs01_00206853 predicted 365
3 SASI_Hs01_00206854 predicted 358
4 SASI_Hs01_00206856 predicted 1337
5 SASI_Hs01_00206857 predicted 240
6 SASI_Hs01_00206859 predicted 280
7 SASI_Hs01_00206860 predicted 1561
8 SASI_Hs01_00206861 predicted 1557
9 SASI_Hs02_00342498 predicted 1576
10 SASI_Hs02_00342499 predicted 373
11 SASI_Hs01_00206855 predicted 1026
12 SASI_Hs01_00206858 predicted 1214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006866
LILRA2 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-390s1c1
Sequence:CCGGCCACAATCACTCATCAGAGTACTCGAGTACTCTGATGAGTGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-837s1c1
Sequence:CCGGCGACAGATTTGTTCTGTATAACTCGAGTTATACAGAACAAATCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-250s1c1
Sequence:CCGGGCTGAGGAGTACCATCTATATCTCGAGATATAGATGGTACTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-1362s1c1
Sequence:CCGGCCAGGATTACACAGTGGAGAACTCGAGTTCTCCACTGTGTAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-366s1c1
Sequence:CCGGGCGGTATCACTGTCAGTACTACTCGAGTAGTACTGACAGTGATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1457s21c1
Sequence:CCGGCCAGAGAAGCCTACAAGATGCCTCGAGGCATCTTGTAGGCTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-292s21c1
Sequence:CCGGCCTGGGTTAGACGGATACAAGCTCGAGCTTGTATCCGTCTAACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1035s21c1
Sequence:CCGGATCACAGGACAGTTCTATGACCTCGAGGTCATAGAACTGTCCTGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1268s21c1
Sequence:CCGGCAGATGCTACAGCTCACTCAGCTCGAGCTGAGTGAGCTGTAGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006866
LILRA2 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-390s1c1
Sequence:CCGGCCACAATCACTCATCAGAGTACTCGAGTACTCTGATGAGTGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-837s1c1
Sequence:CCGGCGACAGATTTGTTCTGTATAACTCGAGTTATACAGAACAAATCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-250s1c1
Sequence:CCGGGCTGAGGAGTACCATCTATATCTCGAGATATAGATGGTACTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-1362s1c1
Sequence:CCGGCCAGGATTACACAGTGGAGAACTCGAGTTCTCCACTGTGTAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-366s1c1
Sequence:CCGGGCGGTATCACTGTCAGTACTACTCGAGTAGTACTGACAGTGATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1457s21c1
Sequence:CCGGCCAGAGAAGCCTACAAGATGCCTCGAGGCATCTTGTAGGCTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-292s21c1
Sequence:CCGGCCTGGGTTAGACGGATACAAGCTCGAGCTTGTATCCGTCTAACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1035s21c1
Sequence:CCGGATCACAGGACAGTTCTATGACCTCGAGGTCATAGAACTGTCCTGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1268s21c1
Sequence:CCGGCAGATGCTACAGCTCACTCAGCTCGAGCTGAGTGAGCTGTAGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006866
LILRA2 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-390s1c1
Sequence:CCGGCCACAATCACTCATCAGAGTACTCGAGTACTCTGATGAGTGATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-837s1c1
Sequence:CCGGCGACAGATTTGTTCTGTATAACTCGAGTTATACAGAACAAATCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-250s1c1
Sequence:CCGGGCTGAGGAGTACCATCTATATCTCGAGATATAGATGGTACTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-1362s1c1
Sequence:CCGGCCAGGATTACACAGTGGAGAACTCGAGTTCTCCACTGTGTAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006866.1-366s1c1
Sequence:CCGGGCGGTATCACTGTCAGTACTACTCGAGTAGTACTGACAGTGATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1457s21c1
Sequence:CCGGCCAGAGAAGCCTACAAGATGCCTCGAGGCATCTTGTAGGCTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-292s21c1
Sequence:CCGGCCTGGGTTAGACGGATACAAGCTCGAGCTTGTATCCGTCTAACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1035s21c1
Sequence:CCGGATCACAGGACAGTTCTATGACCTCGAGGTCATAGAACTGTCCTGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006866.2-1268s21c1
Sequence:CCGGCAGATGCTACAGCTCACTCAGCTCGAGCTGAGTGAGCTGTAGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)