EMAIL THIS PAGE TO A FRIEND

LILRA3

leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3

21 Gene Product Result for
Synonyms: CD85E HM31 HM43 ILT-6 ILT6 LIR-4 LIR4 e3
Species: Human LILRA3(11026)
Gene ID:
Human(11026) Summary: Leukocyte Ig-like receptors (LIRs) are a family of immunoreceptors expressed predominantly on monocytes and B cells and at lower levels on dendritic cells and natural killer (NK) cells. All LIRs in subfamily B have an inhibitory function (see, e.g., LILRB1, MIM 604811). LIRs in subfamily A, with short cytoplasmic domains lacking an immunoreceptor tyrosine-based inhibitory motif (ITIM) and with transmembrane regions containing a charged arginine residue, may initiate stimulatory cascades (see LILRA1, MIM 604810). One member of subfamily A (LILRA3) lacks a transmembrane region and is presumed to be a soluble receptor (Borges et al., 1997 [PubMed 9548455]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006865 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081164 predicted 475
2 SASI_Hs01_00081165 predicted 342
3 SASI_Hs01_00081168 predicted 1364
4 SASI_Hs01_00081170 predicted 1502
5 SASI_Hs01_00081173 predicted 1373
6 SASI_Hs02_00342495 predicted 1394
7 SASI_Hs01_00081169 predicted 1498
8 SASI_Hs01_00081171 predicted 1496
9 SASI_Hs02_00342496 predicted 1489
10 SASI_Hs02_00342497 predicted 1437
11 SASI_Hs01_00081166 predicted 266
12 SASI_Hs01_00081167 predicted 340
13 SASI_Hs01_00081172 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006865
VALIDATED
LILRA3 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-577s21c1
Sequence:CCGGATTCCCATGCCCGTGGGTCATCTCGAGATGACCCACGGGCATGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-346s21c1
Sequence:CCGGGGCGGTATTGCTGTATCTATGCTCGAGCATAGATACAGCAATACCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1175s21c1
Sequence:CCGGATCAAAGCGCCAATCTCATAACTCGAGTTATGAGATTGGCGCTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-485s21c1
Sequence:CCGGTGTGACCATCCAGTGTGACTCCTCGAGGAGTCACACTGGATGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1383s21c1
Sequence:CCGGTGAGGAGATGCTTGCCGTGATCTCGAGATCACGGCAAGCATCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-360s21c1
Sequence:CCGGATCTATGGCAGCCACACTGTACTCGAGTACAGTGTGGCTGCCATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1181s1c1
Sequence:CCGGGCGCCAATCTCATAAGTACCACTCGAGTGGTACTTATGAGATTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-344s1c1
Sequence:CCGGAGGGCGGTATTGCTGTATCTACTCGAGTAGATACAGCAATACCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-672s1c1
Sequence:CCGGCGCGCTCCCTATGTGTGGTCTCTCGAGAGACCACACATAGGGAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006865.2-510s1c1
Sequence:CCGGGTGGCATTTGATGGCTTCATTCTCGAGAATGAAGCCATCAAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1114s1c1
Sequence:CCGGGAGGGATGCACACTTTCCTTTCTCGAGAAAGGAAAGTGTGCATCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006865
VALIDATED
LILRA3 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-577s21c1
Sequence:CCGGATTCCCATGCCCGTGGGTCATCTCGAGATGACCCACGGGCATGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-346s21c1
Sequence:CCGGGGCGGTATTGCTGTATCTATGCTCGAGCATAGATACAGCAATACCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1175s21c1
Sequence:CCGGATCAAAGCGCCAATCTCATAACTCGAGTTATGAGATTGGCGCTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-485s21c1
Sequence:CCGGTGTGACCATCCAGTGTGACTCCTCGAGGAGTCACACTGGATGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1383s21c1
Sequence:CCGGTGAGGAGATGCTTGCCGTGATCTCGAGATCACGGCAAGCATCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-360s21c1
Sequence:CCGGATCTATGGCAGCCACACTGTACTCGAGTACAGTGTGGCTGCCATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1181s1c1
Sequence:CCGGGCGCCAATCTCATAAGTACCACTCGAGTGGTACTTATGAGATTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-344s1c1
Sequence:CCGGAGGGCGGTATTGCTGTATCTACTCGAGTAGATACAGCAATACCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-672s1c1
Sequence:CCGGCGCGCTCCCTATGTGTGGTCTCTCGAGAGACCACACATAGGGAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006865.2-510s1c1
Sequence:CCGGGTGGCATTTGATGGCTTCATTCTCGAGAATGAAGCCATCAAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1114s1c1
Sequence:CCGGGAGGGATGCACACTTTCCTTTCTCGAGAAAGGAAAGTGTGCATCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006865
VALIDATED
LILRA3 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-577s21c1
Sequence:CCGGATTCCCATGCCCGTGGGTCATCTCGAGATGACCCACGGGCATGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-346s21c1
Sequence:CCGGGGCGGTATTGCTGTATCTATGCTCGAGCATAGATACAGCAATACCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1175s21c1
Sequence:CCGGATCAAAGCGCCAATCTCATAACTCGAGTTATGAGATTGGCGCTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-485s21c1
Sequence:CCGGTGTGACCATCCAGTGTGACTCCTCGAGGAGTCACACTGGATGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-1383s21c1
Sequence:CCGGTGAGGAGATGCTTGCCGTGATCTCGAGATCACGGCAAGCATCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006865.2-360s21c1
Sequence:CCGGATCTATGGCAGCCACACTGTACTCGAGTACAGTGTGGCTGCCATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1181s1c1
Sequence:CCGGGCGCCAATCTCATAAGTACCACTCGAGTGGTACTTATGAGATTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-344s1c1
Sequence:CCGGAGGGCGGTATTGCTGTATCTACTCGAGTAGATACAGCAATACCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-672s1c1
Sequence:CCGGCGCGCTCCCTATGTGTGGTCTCTCGAGAGACCACACATAGGGAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006865.2-510s1c1
Sequence:CCGGGTGGCATTTGATGGCTTCATTCTCGAGAATGAAGCCATCAAATGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006865.2-1114s1c1
Sequence:CCGGGAGGGATGCACACTTTCCTTTCTCGAGAAAGGAAAGTGTGCATCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)