EMAIL THIS PAGE TO A FRIEND

LILRA4

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4

26 Gene Product Result for
Synonyms: CD85g ILT7
UniProtKB ID: P59901, Q32MC4
Gene ID:
Human(23547) Summary: This gene encodes an immunoglobulin-like cell surface protein preferentially expressed in plasmacytoid dendritic cells (PDCs). This gene is highly expressed in PDCs, and is found to be rapidly down-regulated by interleukin 3 (IL3). This gene is one of the 19 highly related genes that form a leukocyte receptor gene cluster (LRC) at chromosomal region 19q13.4. [provided by RefSeq, Jul 2008]
cow(618411) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
cow(790068) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
domestic guinea pig(101789180) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111531 MISSION® esiRNA esiRNA human LILRA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012276 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344007 predicted 634
2 SASI_Hs01_00195673 predicted 332
3 SASI_Hs01_00195674 predicted 247
4 SASI_Hs01_00195675 predicted 242
5 SASI_Hs01_00195676 predicted 690
6 SASI_Hs01_00195678 predicted 240
7 SASI_Hs02_00344008 predicted 339
8 SASI_Hs01_00195679 predicted 698
9 SASI_Hs02_00344009 predicted 512
10 SASI_Hs01_00195682 predicted 1098
11 SASI_Hs01_00195677 predicted 240
12 SASI_Hs01_00195680 predicted 237
13 SASI_Hs01_00195681 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012276
LILRA4 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-495s1c1
Sequence:CCGGCCTGAACTCACACCAACACAACTCGAGTTGTGTTGGTGTGAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-574s1c1
Sequence:CCGGACATTCAGATGCTACGGCTATCTCGAGATAGCCGTAGCATCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-747s1c1
Sequence:CCGGCTACATCAGATACACTCTGTACTCGAGTACAGAGTGTATCTGATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-297s21c1
Sequence:CCGGGGTCAAACTCTCCATCCCATCCTCGAGGATGGGATGGAGAGTTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-505s21c1
Sequence:CCGGGGCAGGTTCACTCTGATTGAGCTCGAGCTCAATCAGAGTGAACCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-1507s21c1
Sequence:CCGGAGAAAGGACAATGCACCCTTCCTCGAGGAAGGGTGCATTGTCCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-342s21c1
Sequence:CCGGATATCACTGTTACTATCAGAGCTCGAGCTCTGATAGTAACAGTGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012276
LILRA4 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-495s1c1
Sequence:CCGGCCTGAACTCACACCAACACAACTCGAGTTGTGTTGGTGTGAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-574s1c1
Sequence:CCGGACATTCAGATGCTACGGCTATCTCGAGATAGCCGTAGCATCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-747s1c1
Sequence:CCGGCTACATCAGATACACTCTGTACTCGAGTACAGAGTGTATCTGATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-297s21c1
Sequence:CCGGGGTCAAACTCTCCATCCCATCCTCGAGGATGGGATGGAGAGTTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-505s21c1
Sequence:CCGGGGCAGGTTCACTCTGATTGAGCTCGAGCTCAATCAGAGTGAACCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-1507s21c1
Sequence:CCGGAGAAAGGACAATGCACCCTTCCTCGAGGAAGGGTGCATTGTCCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-342s21c1
Sequence:CCGGATATCACTGTTACTATCAGAGCTCGAGCTCTGATAGTAACAGTGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012276
LILRA4 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-495s1c1
Sequence:CCGGCCTGAACTCACACCAACACAACTCGAGTTGTGTTGGTGTGAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-574s1c1
Sequence:CCGGACATTCAGATGCTACGGCTATCTCGAGATAGCCGTAGCATCTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012276.2-747s1c1
Sequence:CCGGCTACATCAGATACACTCTGTACTCGAGTACAGAGTGTATCTGATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-297s21c1
Sequence:CCGGGGTCAAACTCTCCATCCCATCCTCGAGGATGGGATGGAGAGTTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-505s21c1
Sequence:CCGGGGCAGGTTCACTCTGATTGAGCTCGAGCTCAATCAGAGTGAACCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-1507s21c1
Sequence:CCGGAGAAAGGACAATGCACCCTTCCTCGAGGAAGGGTGCATTGTCCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012276.3-342s21c1
Sequence:CCGGATATCACTGTTACTATCAGAGCTCGAGCTCTGATAGTAACAGTGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)