EMAIL THIS PAGE TO A FRIEND

LILRA5

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5

81 Gene Product Result for
Synonyms: CD85 CD85F ILT-11 ILT11 LILRB7 LIR-9 LIR9
UniProtKB ID: A6NI73, A6NHI3
Gene ID:
Human(353514) Summary: The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(232801) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Rat(691533) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301930 ANTI-LILRA5 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147151 MISSION® esiRNA esiRNA targeting mouse Lilra5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021250 Rosetta Predictions human pricing
NM_181879 Rosetta Predictions human pricing
NM_181985 Rosetta Predictions human pricing
NM_181986 Rosetta Predictions human pricing
NM_001076793 Rosetta Predictions rat pricing
NM_001081239 Rosetta Predictions mouse pricing
XM_486062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020491 predicted 610
2 SASI_Hs01_00020492 predicted 457
3 SASI_Hs01_00020493 predicted 610
4 SASI_Hs01_00020494 predicted 601
5 SASI_Hs01_00020495 predicted 601
6 SASI_Hs01_00020496 predicted 607
7 SASI_Hs01_00020497 predicted 595
8 SASI_Hs01_00020498 predicted 754
9 SASI_Hs01_00020499 predicted 119
10 SASI_Hs01_00020500 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089149 predicted 569
2 SASI_Hs01_00089150 predicted 417
3 SASI_Hs01_00089151 predicted 569
4 SASI_Hs01_00089152 predicted 559
5 SASI_Hs01_00089153 predicted 559
6 SASI_Hs01_00089154 predicted 567
7 SASI_Hs01_00089155 predicted 554
8 SASI_Hs01_00089156 predicted 711
9 SASI_Hs01_00089157 predicted 79
10 SASI_Hs01_00089158 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036346 predicted 533
2 SASI_Hs01_00036347 predicted 384
3 SASI_Hs01_00036348 predicted 534
4 SASI_Hs01_00036349 predicted 525
5 SASI_Hs01_00036350 predicted 522
6 SASI_Hs01_00036351 predicted 530
7 SASI_Hs01_00036352 predicted 523
8 SASI_Hs01_00036353 predicted 678
9 SASI_Hs01_00036354 predicted 79
10 SASI_Hs01_00036355 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212011 predicted 535
2 SASI_Hs01_00212012 predicted 381
3 SASI_Hs01_00212013 predicted 528
4 SASI_Hs01_00212014 predicted 524
5 SASI_Hs01_00212015 predicted 524
6 SASI_Hs01_00212016 predicted 534
7 SASI_Hs01_00212017 predicted 525
8 SASI_Hs01_00212018 predicted 677
9 SASI_Hs01_00212019 predicted 81
10 SASI_Hs01_00212020 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207472 predicted 449
2 SASI_Rn02_00207473 predicted 581
3 SASI_Rn02_00207474 predicted 341
4 SASI_Rn02_00207475 predicted 256
5 SASI_Rn02_00207476 predicted 240
6 SASI_Rn02_00207477 predicted 446
7 SASI_Rn02_00207478 predicted 797
8 SASI_Rn02_00207479 predicted 491
9 SASI_Rn02_00207480 predicted 758
10 SASI_Rn02_00207481 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296537 predicted 826
2 SASI_Mm02_00296538 predicted 494
3 SASI_Mm02_00296539 predicted 224
4 SASI_Mm02_00296540 predicted 585
5 SASI_Mm02_00296541 predicted 284
6 SASI_Mm02_00296542 predicted 446
7 SASI_Mm02_00296543 predicted 527
8 SASI_Mm02_00296544 predicted 475
9 SASI_Mm02_00296545 predicted 1384
10 SASI_Mm02_00296546 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224974 predicted 633
2 SASI_Mm01_00224975 predicted 531
3 SASI_Mm01_00224976 predicted 636
4 SASI_Mm01_00224977 predicted 586
5 SASI_Mm01_00224978 predicted 582
6 SASI_Mm01_00224979 predicted 530
7 SASI_Mm01_00224980 predicted 562
8 SASI_Mm01_00224981 predicted 625
9 SASI_Mm01_00224982 predicted 581
10 SASI_Mm01_00224983 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021250
LILRA5 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-616s1c1
Sequence:CCGGCTGAGATTCGACAGGTTCATTCTCGAGAATGAACCTGTCGAATCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-773s1c1
Sequence:CCGGGCAGGCATATCCTGCAGGTATCTCGAGATACCTGCAGGATATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-841s1c1
Sequence:CCGGGATAACCTCAGTCCGTCACAACTCGAGTTGTGACGGACTGAGGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-894s1c1
Sequence:CCGGTCAGGATTACGCAGTAGAGAACTCGAGTTCTCTACTGCGTAATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-339s1c1
Sequence:CCGGCCAGGAATACCGTCTGGTTAACTCGAGTTAACCAGACGGTATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1030s21c1
Sequence:CCGGAGAACAATGCACCATTGAATGCTCGAGCATTCAATGGTGCATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021250.2-457s21c1
Sequence:CCGGAGATACCGCTGTTACTACTACCTCGAGGTAGTAGTAACAGCGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1119s21c1
Sequence:CCGGTGGACTGTCTGCTGGCAATTTCTCGAGAAATTGCCAGCAGACAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021250
LILRA5 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-616s1c1
Sequence:CCGGCTGAGATTCGACAGGTTCATTCTCGAGAATGAACCTGTCGAATCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-773s1c1
Sequence:CCGGGCAGGCATATCCTGCAGGTATCTCGAGATACCTGCAGGATATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-841s1c1
Sequence:CCGGGATAACCTCAGTCCGTCACAACTCGAGTTGTGACGGACTGAGGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-894s1c1
Sequence:CCGGTCAGGATTACGCAGTAGAGAACTCGAGTTCTCTACTGCGTAATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-339s1c1
Sequence:CCGGCCAGGAATACCGTCTGGTTAACTCGAGTTAACCAGACGGTATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1030s21c1
Sequence:CCGGAGAACAATGCACCATTGAATGCTCGAGCATTCAATGGTGCATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021250.2-457s21c1
Sequence:CCGGAGATACCGCTGTTACTACTACCTCGAGGTAGTAGTAACAGCGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1119s21c1
Sequence:CCGGTGGACTGTCTGCTGGCAATTTCTCGAGAAATTGCCAGCAGACAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021250
LILRA5 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-616s1c1
Sequence:CCGGCTGAGATTCGACAGGTTCATTCTCGAGAATGAACCTGTCGAATCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-773s1c1
Sequence:CCGGGCAGGCATATCCTGCAGGTATCTCGAGATACCTGCAGGATATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-841s1c1
Sequence:CCGGGATAACCTCAGTCCGTCACAACTCGAGTTGTGACGGACTGAGGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-894s1c1
Sequence:CCGGTCAGGATTACGCAGTAGAGAACTCGAGTTCTCTACTGCGTAATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021250.2-339s1c1
Sequence:CCGGCCAGGAATACCGTCTGGTTAACTCGAGTTAACCAGACGGTATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1030s21c1
Sequence:CCGGAGAACAATGCACCATTGAATGCTCGAGCATTCAATGGTGCATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021250.2-457s21c1
Sequence:CCGGAGATACCGCTGTTACTACTACCTCGAGGTAGTAGTAACAGCGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021250.2-1119s21c1
Sequence:CCGGTGGACTGTCTGCTGGCAATTTCTCGAGAAATTGCCAGCAGACAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486062
LILRA5 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486062.2-1987s1c1
Sequence:CCGGGCCACTTACAATTCTTCCTAACTCGAGTTAGGAAGAATTGTAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-371s1c1
Sequence:CCGGCCCGGGAATACCGTCTTTATACTCGAGTATAAAGACGGTATTCCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-969s1c1
Sequence:CCGGCCTGGGAATAAGTCCAAGGATCTCGAGATCCTTGGACTTATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-722s1c1
Sequence:CCGGCCCAGCGATCTCTTGGAAATACTCGAGTATTTCCAAGAGATCGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-101s1c1
Sequence:CCGGGCTACAAGATAACTGATCTATCTCGAGATAGATCAGTTATCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486062
LILRA5 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486062.2-1987s1c1
Sequence:CCGGGCCACTTACAATTCTTCCTAACTCGAGTTAGGAAGAATTGTAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-371s1c1
Sequence:CCGGCCCGGGAATACCGTCTTTATACTCGAGTATAAAGACGGTATTCCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-969s1c1
Sequence:CCGGCCTGGGAATAAGTCCAAGGATCTCGAGATCCTTGGACTTATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-722s1c1
Sequence:CCGGCCCAGCGATCTCTTGGAAATACTCGAGTATTTCCAAGAGATCGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-101s1c1
Sequence:CCGGGCTACAAGATAACTGATCTATCTCGAGATAGATCAGTTATCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486062
LILRA5 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486062.2-1987s1c1
Sequence:CCGGGCCACTTACAATTCTTCCTAACTCGAGTTAGGAAGAATTGTAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-371s1c1
Sequence:CCGGCCCGGGAATACCGTCTTTATACTCGAGTATAAAGACGGTATTCCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-969s1c1
Sequence:CCGGCCTGGGAATAAGTCCAAGGATCTCGAGATCCTTGGACTTATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-722s1c1
Sequence:CCGGCCCAGCGATCTCTTGGAAATACTCGAGTATTTCCAAGAGATCGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486062.2-101s1c1
Sequence:CCGGGCTACAAGATAACTGATCTATCTCGAGATAGATCAGTTATCTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)