EMAIL THIS PAGE TO A FRIEND

LILRA6

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6

35 Gene Product Result for
Synonyms: CD85b ILT-8 ILT5 ILT8 LILRB3 LILRB6
UniProtKB ID: Q6PI73
Gene ID:
Mouse(18726) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
domestic cat(101082358) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
cow(100852090) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Horse(100054075) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
sheep(101106790) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
domestic guinea pig(100728783) leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024318 Rosetta Predictions human pricing
NM_011090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356659 predicted 399
2 SASI_Hs02_00356660 predicted 288
3 SASI_Hs02_00356661 predicted 1360
4 SASI_Hs02_00356662 predicted 546
5 SASI_Hs01_00243276 predicted 1007
6 SASI_Hs01_00243278 predicted 1070
7 SASI_Hs01_00243279 predicted 398
8 SASI_Hs01_00243277 predicted 556
9 SASI_Hs01_00243283 predicted 1428
10 SASI_Hs02_00356663 predicted 402
11 SASI_Hs01_00243275 predicted 585
12 SASI_Hs01_00243280 predicted 427
13 SASI_Hs01_00243281 predicted 589
14 SASI_Hs01_00243282 predicted 1253
15 SASI_Hs01_00243284 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111477 predicted 1877
2 SASI_Mm01_00111473 predicted 1338
3 SASI_Mm01_00111474 predicted 292
4 SASI_Mm01_00111475 predicted 289
5 SASI_Mm01_00111476 predicted 1998
6 SASI_Mm01_00111478 predicted 1996
7 SASI_Mm01_00111479 predicted 2030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011090
LILRA6 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-452s1c1
Sequence:CCGGCAGAGCTATCACAGGTTCATTCTCGAGAATGAACCTGTGATAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1336s1c1
Sequence:CCGGGCAGTGTTACTCTGACATCAACTCGAGTTGATGTCAGAGTAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-130s1c1
Sequence:CCGGAGTGTGGACTAAGGTGACCTTCTCGAGAAGGTCACCTTAGTCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1442s1c1
Sequence:CCGGGCCAACTTCACACTTGGCTATCTCGAGATAGCCAAGTGTGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-520s1c1
Sequence:CCGGGTATAACATCTCTACAGGGAACTCGAGTTCCCTGTAGAGATGTTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011090
LILRA6 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-452s1c1
Sequence:CCGGCAGAGCTATCACAGGTTCATTCTCGAGAATGAACCTGTGATAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1336s1c1
Sequence:CCGGGCAGTGTTACTCTGACATCAACTCGAGTTGATGTCAGAGTAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-130s1c1
Sequence:CCGGAGTGTGGACTAAGGTGACCTTCTCGAGAAGGTCACCTTAGTCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1442s1c1
Sequence:CCGGGCCAACTTCACACTTGGCTATCTCGAGATAGCCAAGTGTGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-520s1c1
Sequence:CCGGGTATAACATCTCTACAGGGAACTCGAGTTCCCTGTAGAGATGTTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011090
LILRA6 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-452s1c1
Sequence:CCGGCAGAGCTATCACAGGTTCATTCTCGAGAATGAACCTGTGATAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1336s1c1
Sequence:CCGGGCAGTGTTACTCTGACATCAACTCGAGTTGATGTCAGAGTAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-130s1c1
Sequence:CCGGAGTGTGGACTAAGGTGACCTTCTCGAGAAGGTCACCTTAGTCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-1442s1c1
Sequence:CCGGGCCAACTTCACACTTGGCTATCTCGAGATAGCCAAGTGTGAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011090.1-520s1c1
Sequence:CCGGGTATAACATCTCTACAGGGAACTCGAGTTCCCTGTAGAGATGTTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024318
LILRA6 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-256s1c1
Sequence:CCGGCCATCCATAACAGAGCACCATCTCGAGATGGTGCTCTGTTATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-208s1c1
Sequence:CCGGGACAGAAATAACCCACTGGAACTCGAGTTCCAGTGGGTTATTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1095s1c1
Sequence:CCGGGCTGCGTCTGAGATCAATGTACTCGAGTACATTGATCTCAGACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1054s1c1
Sequence:CCGGGACACTTTCCTTCTGACCAAACTCGAGTTTGGTCAGAAGGAAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1705s21c1
Sequence:CCGGATCATGTCTGATCACAAATTTCTCGAGAAATTTGTGATCAGACATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1735s21c1
Sequence:CCGGACCTTACTTCCAATCTATGTTCTCGAGAACATAGATTGGAAGTAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-2022s21c1
Sequence:CCGGAGGGATCAATGTTGAGGTATTCTCGAGAATACCTCAACATTGATCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024318
LILRA6 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-256s1c1
Sequence:CCGGCCATCCATAACAGAGCACCATCTCGAGATGGTGCTCTGTTATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-208s1c1
Sequence:CCGGGACAGAAATAACCCACTGGAACTCGAGTTCCAGTGGGTTATTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1095s1c1
Sequence:CCGGGCTGCGTCTGAGATCAATGTACTCGAGTACATTGATCTCAGACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1054s1c1
Sequence:CCGGGACACTTTCCTTCTGACCAAACTCGAGTTTGGTCAGAAGGAAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1705s21c1
Sequence:CCGGATCATGTCTGATCACAAATTTCTCGAGAAATTTGTGATCAGACATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1735s21c1
Sequence:CCGGACCTTACTTCCAATCTATGTTCTCGAGAACATAGATTGGAAGTAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-2022s21c1
Sequence:CCGGAGGGATCAATGTTGAGGTATTCTCGAGAATACCTCAACATTGATCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024318
LILRA6 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-256s1c1
Sequence:CCGGCCATCCATAACAGAGCACCATCTCGAGATGGTGCTCTGTTATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-208s1c1
Sequence:CCGGGACAGAAATAACCCACTGGAACTCGAGTTCCAGTGGGTTATTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1095s1c1
Sequence:CCGGGCTGCGTCTGAGATCAATGTACTCGAGTACATTGATCTCAGACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024318.1-1054s1c1
Sequence:CCGGGACACTTTCCTTCTGACCAAACTCGAGTTTGGTCAGAAGGAAAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1705s21c1
Sequence:CCGGATCATGTCTGATCACAAATTTCTCGAGAAATTTGTGATCAGACATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-1735s21c1
Sequence:CCGGACCTTACTTCCAATCTATGTTCTCGAGAACATAGATTGGAAGTAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024318.2-2022s21c1
Sequence:CCGGAGGGATCAATGTTGAGGTATTCTCGAGAATACCTCAACATTGATCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)