EMAIL THIS PAGE TO A FRIEND

LILRB1

leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1

60 Gene Product Result for
Synonyms: CD85J ILT-2 ILT2 LIR-1 LIR1 MIR-7 MIR7
Species: Human LILRB1(10859)
Gene ID:
Human(10859) Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1532 Human ILT-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081637 Rosetta Predictions human pricing
NM_001081638 Rosetta Predictions human pricing
NM_001081639 Rosetta Predictions human pricing
NM_006669 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316473 predicted 574
2 SASI_Hs02_00316474 predicted 440
3 SASI_Hs02_00316475 predicted 2254
4 SASI_Hs02_00316476 predicted 2143
5 SASI_Hs02_00316477 predicted 884
6 SASI_Hs02_00316478 predicted 904
7 SASI_Hs02_00316479 predicted 2257
8 SASI_Hs02_00316480 predicted 1248
9 SASI_Hs02_00316481 predicted 870
10 SASI_Hs02_00316482 predicted 2258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316483 predicted 628
2 SASI_Hs02_00316484 predicted 503
3 SASI_Hs02_00316485 predicted 2306
4 SASI_Hs02_00316486 predicted 2202
5 SASI_Hs02_00316487 predicted 943
6 SASI_Hs02_00316488 predicted 961
7 SASI_Hs02_00316489 predicted 2320
8 SASI_Hs02_00316490 predicted 1314
9 SASI_Hs02_00316491 predicted 934
10 SASI_Hs02_00316492 predicted 2317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316493 predicted 630
2 SASI_Hs02_00316494 predicted 498
3 SASI_Hs02_00316495 predicted 2305
4 SASI_Hs02_00316496 predicted 2201
5 SASI_Hs02_00316497 predicted 939
6 SASI_Hs02_00316498 predicted 960
7 SASI_Hs02_00316499 predicted 2321
8 SASI_Hs02_00316500 predicted 1312
9 SASI_Hs02_00316501 predicted 933
10 SASI_Hs02_00316502 predicted 2317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342064 predicted 751
2 SASI_Hs02_00342065 predicted 614
3 SASI_Hs01_00212672 predicted 2422
4 SASI_Hs02_00342066 predicted 2313
5 SASI_Hs02_00342067 predicted 1059
6 SASI_Hs02_00342068 predicted 1073
7 SASI_Hs01_00212674 predicted 2431
8 SASI_Hs02_00342069 predicted 1423
9 SASI_Hs02_00342070 predicted 1049
10 SASI_Hs01_00212679 predicted 2431
11 SASI_Hs01_00212671 predicted 2022
12 SASI_Hs01_00212673 predicted 2417
13 SASI_Hs01_00212675 predicted 740
14 SASI_Hs01_00212676 predicted 629
15 SASI_Hs01_00212677 predicted 1449
16 SASI_Hs01_00212678 predicted 1451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006669
LILRB1 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006669.2-2680s1c1
Sequence:CCGGCGCCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1443s1c1
Sequence:CCGGGTCTAAGATCAACGTACCAATCTCGAGATTGGTACGTTGATCTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-630s1c1
Sequence:CCGGGCTGTTACTATGGTAGCGACACTCGAGTGTCGCTACCATAGTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1299s1c1
Sequence:CCGGGACAGTTCTATGACAGAGTCTCTCGAGAGACTCTGTCATAGAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2514s21c1
Sequence:CCGGTAAGTCAGAAAGTGCATTAAACTCGAGTTTAATGCACTTTCTGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2422s21c1
Sequence:CCGGCACTCAATTCTGCAGTATAAACTCGAGTTTATACTGCAGAATTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006669.3-745s21c1
Sequence:CCGGGAACTCAGGAGGGAATGTAATCTCGAGATTACATTCCCTCCTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1088s1c2
Sequence:CCGGGCTGGCTACAACAGATTTGTTCTCGAGAACAAATCTGTTGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006669
LILRB1 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006669.2-2680s1c1
Sequence:CCGGCGCCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1443s1c1
Sequence:CCGGGTCTAAGATCAACGTACCAATCTCGAGATTGGTACGTTGATCTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-630s1c1
Sequence:CCGGGCTGTTACTATGGTAGCGACACTCGAGTGTCGCTACCATAGTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1299s1c1
Sequence:CCGGGACAGTTCTATGACAGAGTCTCTCGAGAGACTCTGTCATAGAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2514s21c1
Sequence:CCGGTAAGTCAGAAAGTGCATTAAACTCGAGTTTAATGCACTTTCTGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2422s21c1
Sequence:CCGGCACTCAATTCTGCAGTATAAACTCGAGTTTATACTGCAGAATTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006669.3-745s21c1
Sequence:CCGGGAACTCAGGAGGGAATGTAATCTCGAGATTACATTCCCTCCTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1088s1c2
Sequence:CCGGGCTGGCTACAACAGATTTGTTCTCGAGAACAAATCTGTTGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006669
LILRB1 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006669.2-2680s1c1
Sequence:CCGGCGCCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1443s1c1
Sequence:CCGGGTCTAAGATCAACGTACCAATCTCGAGATTGGTACGTTGATCTTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-630s1c1
Sequence:CCGGGCTGTTACTATGGTAGCGACACTCGAGTGTCGCTACCATAGTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1299s1c1
Sequence:CCGGGACAGTTCTATGACAGAGTCTCTCGAGAGACTCTGTCATAGAACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2514s21c1
Sequence:CCGGTAAGTCAGAAAGTGCATTAAACTCGAGTTTAATGCACTTTCTGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006669.3-2422s21c1
Sequence:CCGGCACTCAATTCTGCAGTATAAACTCGAGTTTATACTGCAGAATTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006669.3-745s21c1
Sequence:CCGGGAACTCAGGAGGGAATGTAATCTCGAGATTACATTCCCTCCTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006669.2-1088s1c2
Sequence:CCGGGCTGGCTACAACAGATTTGTTCTCGAGAACAAATCTGTTGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)