EMAIL THIS PAGE TO A FRIEND

LILRB2

leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2

38 Gene Product Result for
Synonyms: CD85D ILT-4 ILT4 LIR-2 LIR2 MIR-10 MIR10
UniProtKB ID: Q8N423, O75017, Q8NHJ7, Q8NHJ8
Gene ID:
Human(10288) Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
dog(484309) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005874 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147581 MISSION® esiRNA esiRNA human LILRB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080978 Rosetta Predictions human pricing
NM_005874 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316257 predicted 438
2 SASI_Hs02_00316258 predicted 389
3 SASI_Hs02_00316259 predicted 514
4 SASI_Hs02_00316260 predicted 2036
5 SASI_Hs02_00316261 predicted 2173
6 SASI_Hs02_00316262 predicted 2274
7 SASI_Hs02_00316263 predicted 2184
8 SASI_Hs02_00316264 predicted 2319
9 SASI_Hs02_00316265 predicted 2180
10 SASI_Hs02_00316266 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245462 predicted 434
2 SASI_Hs01_00245464 predicted 391
3 SASI_Hs01_00245463 predicted 519
4 SASI_Hs01_00245469 predicted 2046
5 SASI_Hs02_00340450 predicted 2176
6 SASI_Hs02_00340451 predicted 2275
7 SASI_Hs02_00340452 predicted 2186
8 SASI_Hs02_00340453 predicted 2324
9 SASI_Hs02_00340454 predicted 2175
10 SASI_Hs02_00340455 predicted 2285
11 SASI_Hs01_00245465 predicted 1285
12 SASI_Hs01_00245466 predicted 462
13 SASI_Hs01_00245467 predicted 362
14 SASI_Hs01_00245468 predicted 467
15 SASI_Hs01_00245470 predicted 458
16 SASI_Hs01_00245471 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005874
LILRB2 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2311s21c1
Sequence:CCGGGAAGTAAGAATGTGCTTTAAACTCGAGTTTAAAGCACATTCTTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2433s21c1
Sequence:CCGGTGACGTTGGCTTTCGTATAAGCTCGAGCTTATACGAAAGCCAACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-382s1c1
Sequence:CCGGGCATCTTGGATTACACGGATACTCGAGTATCCGTGTAATCCAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-633s1c1
Sequence:CCGGTGGCGGCTTCATTCTGTGTAACTCGAGTTACACAGAATGAAGCCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1228s1c1
Sequence:CCGGCGGCAGTTCCACACTTTCCTTCTCGAGAAGGAAAGTGTGGAACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-465s1c1
Sequence:CCGGGCGATATGGCTGTCAGTATTACTCGAGTAATACTGACAGCCATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1276s1c1
Sequence:CCGGCCACTCCGTCTAAGATCAATACTCGAGTATTGATCTTAGACGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005874
LILRB2 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2311s21c1
Sequence:CCGGGAAGTAAGAATGTGCTTTAAACTCGAGTTTAAAGCACATTCTTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2433s21c1
Sequence:CCGGTGACGTTGGCTTTCGTATAAGCTCGAGCTTATACGAAAGCCAACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-382s1c1
Sequence:CCGGGCATCTTGGATTACACGGATACTCGAGTATCCGTGTAATCCAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-633s1c1
Sequence:CCGGTGGCGGCTTCATTCTGTGTAACTCGAGTTACACAGAATGAAGCCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1228s1c1
Sequence:CCGGCGGCAGTTCCACACTTTCCTTCTCGAGAAGGAAAGTGTGGAACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-465s1c1
Sequence:CCGGGCGATATGGCTGTCAGTATTACTCGAGTAATACTGACAGCCATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1276s1c1
Sequence:CCGGCCACTCCGTCTAAGATCAATACTCGAGTATTGATCTTAGACGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005874
LILRB2 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2311s21c1
Sequence:CCGGGAAGTAAGAATGTGCTTTAAACTCGAGTTTAAAGCACATTCTTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005874.3-2433s21c1
Sequence:CCGGTGACGTTGGCTTTCGTATAAGCTCGAGCTTATACGAAAGCCAACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-382s1c1
Sequence:CCGGGCATCTTGGATTACACGGATACTCGAGTATCCGTGTAATCCAAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-633s1c1
Sequence:CCGGTGGCGGCTTCATTCTGTGTAACTCGAGTTACACAGAATGAAGCCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1228s1c1
Sequence:CCGGCGGCAGTTCCACACTTTCCTTCTCGAGAAGGAAAGTGTGGAACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-465s1c1
Sequence:CCGGGCGATATGGCTGTCAGTATTACTCGAGTAATACTGACAGCCATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005874.1-1276s1c1
Sequence:CCGGCCACTCCGTCTAAGATCAATACTCGAGTATTGATCTTAGACGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)