EMAIL THIS PAGE TO A FRIEND

LILRB3

leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3

53 Gene Product Result for
Synonyms: CD85A HL9 ILT-5 ILT5 LILRA6 LIR-3 LIR3 PIRB
UniProtKB ID: O75022, C9J1P3, C9JIP1, O15471, Q86U49
Gene ID:
Human(11025) Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(65146) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
cow(507024) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
Horse(100054321) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
domestic cat(101082610) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
cow(790139) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
cow(100139766) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
domestic guinea pig(100728502) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
naked mole-rat(101722653) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081450 Rosetta Predictions human pricing
NM_006864 Rosetta Predictions human pricing
NM_031713 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316333 predicted 278
2 SASI_Hs02_00316334 predicted 384
3 SASI_Hs02_00316335 predicted 525
4 SASI_Hs02_00316336 predicted 1051
5 SASI_Hs02_00316337 predicted 390
6 SASI_Hs02_00316338 predicted 539
7 SASI_Hs02_00316339 predicted 388
8 SASI_Hs02_00316340 predicted 690
9 SASI_Hs02_00316341 predicted 694
10 SASI_Hs02_00316342 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342490 predicted 272
2 SASI_Hs02_00342491 predicted 383
3 SASI_Hs01_00200007 predicted 528
4 SASI_Hs01_00200010 predicted 1055
5 SASI_Hs01_00200011 predicted 389
6 SASI_Hs01_00200012 predicted 542
7 SASI_Hs02_00342492 predicted 389
8 SASI_Hs02_00342493 predicted 691
9 SASI_Hs02_00342494 predicted 697
10 SASI_Hs01_00200013 predicted 2152
11 SASI_Hs01_00200006 predicted 629
12 SASI_Hs01_00200008 predicted 931
13 SASI_Hs01_00200009 predicted 212
14 SASI_Hs01_00200014 predicted 1368
15 SASI_Hs01_00200015 predicted 2141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265076 predicted 347
2 SASI_Rn02_00265077 predicted 396
3 SASI_Rn01_00058805 predicted 1370
4 SASI_Rn02_00265078 predicted 329
5 SASI_Rn01_00058808 predicted 1818
6 SASI_Rn02_00265079 predicted 272
7 SASI_Rn01_00058809 predicted 1257
8 SASI_Rn02_00265080 predicted 973
9 SASI_Rn02_00265081 predicted 570
10 SASI_Rn02_00265082 predicted 423
11 SASI_Rn01_00058804 predicted 1838
12 SASI_Rn01_00058806 predicted 1856
13 SASI_Rn01_00058807 predicted 1361
14 SASI_Rn01_00058810 predicted 1504
15 SASI_Rn01_00058811 predicted 1827
16 SASI_Rn01_00058812 predicted 1081
17 SASI_Rn01_00058813 predicted 1855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006864
LILRB3 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2305s21c1
Sequence:CCGGCCTTGAACACAAGAAGTTAAGCTCGAGCTTAACTTCTTGTGTTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2445s21c1
Sequence:CCGGATTATACATCGAACTTATGACCTCGAGGTCATAAGTTCGATGTATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1153s21c1
Sequence:CCGGTGGTGGCAGTTTGACACTTTCCTCGAGGAAAGTGTCAAACTGCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1412s21c1
Sequence:CCGGCCACACCTGGTCTGGGAAGATCTCGAGATCTTCCCAGACCAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1474s1c1
Sequence:CCGGTGACCAGAGAAAGACTGATTTCTCGAGAAATCAGTCTTTCTCTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1452s1c1
Sequence:CCGGGTCACAGCAAACACAGGACATCTCGAGATGTCCTGTGTTTGCTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-622s1c1
Sequence:CCGGGTGGAGGTTCACATGCTATTACTCGAGTAATAGCATGTGAACCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-472s1c1
Sequence:CCGGCCTCCGATGTGGCTCACAGAACTCGAGTTCTGTGAGCCACATCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1169s1c1
Sequence:CCGGGCTCATAAGTACCAGGCTGAACTCGAGTTCAGCCTGGTACTTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006864
LILRB3 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2305s21c1
Sequence:CCGGCCTTGAACACAAGAAGTTAAGCTCGAGCTTAACTTCTTGTGTTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2445s21c1
Sequence:CCGGATTATACATCGAACTTATGACCTCGAGGTCATAAGTTCGATGTATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1153s21c1
Sequence:CCGGTGGTGGCAGTTTGACACTTTCCTCGAGGAAAGTGTCAAACTGCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1412s21c1
Sequence:CCGGCCACACCTGGTCTGGGAAGATCTCGAGATCTTCCCAGACCAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1474s1c1
Sequence:CCGGTGACCAGAGAAAGACTGATTTCTCGAGAAATCAGTCTTTCTCTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1452s1c1
Sequence:CCGGGTCACAGCAAACACAGGACATCTCGAGATGTCCTGTGTTTGCTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-622s1c1
Sequence:CCGGGTGGAGGTTCACATGCTATTACTCGAGTAATAGCATGTGAACCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-472s1c1
Sequence:CCGGCCTCCGATGTGGCTCACAGAACTCGAGTTCTGTGAGCCACATCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1169s1c1
Sequence:CCGGGCTCATAAGTACCAGGCTGAACTCGAGTTCAGCCTGGTACTTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006864
LILRB3 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2305s21c1
Sequence:CCGGCCTTGAACACAAGAAGTTAAGCTCGAGCTTAACTTCTTGTGTTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006864.2-2445s21c1
Sequence:CCGGATTATACATCGAACTTATGACCTCGAGGTCATAAGTTCGATGTATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1153s21c1
Sequence:CCGGTGGTGGCAGTTTGACACTTTCCTCGAGGAAAGTGTCAAACTGCCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006864.2-1412s21c1
Sequence:CCGGCCACACCTGGTCTGGGAAGATCTCGAGATCTTCCCAGACCAGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1474s1c1
Sequence:CCGGTGACCAGAGAAAGACTGATTTCTCGAGAAATCAGTCTTTCTCTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1452s1c1
Sequence:CCGGGTCACAGCAAACACAGGACATCTCGAGATGTCCTGTGTTTGCTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-622s1c1
Sequence:CCGGGTGGAGGTTCACATGCTATTACTCGAGTAATAGCATGTGAACCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-472s1c1
Sequence:CCGGCCTCCGATGTGGCTCACAGAACTCGAGTTCTGTGAGCCACATCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006864.1-1169s1c1
Sequence:CCGGGCTCATAAGTACCAGGCTGAACTCGAGTTCAGCCTGGTACTTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)