EMAIL THIS PAGE TO A FRIEND

LILRB5

leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5

49 Gene Product Result for
Synonyms: CD85C LIR-8 LIR8
UniProtKB ID: O75023, Q8N760
Gene ID:
Human(10990) Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Several other LIR subfamily B receptors are expressed on immune cells where they bind to MHC class I molecules on antigen-presenting cells and inhibit stimulation of an immune response. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
dog(484306) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114971 MISSION® esiRNA esiRNA human LILRB5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081442 Rosetta Predictions human pricing
NM_001081443 Rosetta Predictions human pricing
NM_006840 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316313 predicted 1135
2 SASI_Hs02_00316314 predicted 1150
3 SASI_Hs02_00316315 predicted 1130
4 SASI_Hs02_00316316 predicted 1143
5 SASI_Hs02_00316317 predicted 1143
6 SASI_Hs02_00316318 predicted 1141
7 SASI_Hs02_00316319 predicted 547
8 SASI_Hs02_00316320 predicted 1571
9 SASI_Hs02_00316321 predicted 1207
10 SASI_Hs02_00316322 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316323 predicted 829
2 SASI_Hs02_00316324 predicted 841
3 SASI_Hs02_00316325 predicted 832
4 SASI_Hs02_00316326 predicted 850
5 SASI_Hs02_00316327 predicted 844
6 SASI_Hs02_00316328 predicted 843
7 SASI_Hs02_00316329 predicted 1265
8 SASI_Hs02_00316330 predicted 1278
9 SASI_Hs02_00316331 predicted 908
10 SASI_Hs02_00316332 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342417 predicted 1129
2 SASI_Hs02_00342418 predicted 1143
3 SASI_Hs02_00342419 predicted 1134
4 SASI_Hs02_00342420 predicted 1149
5 SASI_Hs02_00342421 predicted 1142
6 SASI_Hs02_00342422 predicted 1144
7 SASI_Hs01_00138394 predicted 545
8 SASI_Hs02_00342423 predicted 1561
9 SASI_Hs01_00138395 predicted 1212
10 SASI_Hs02_00342424 predicted 779
11 SASI_Hs01_00138396 predicted 349
12 SASI_Hs01_00138397 predicted 480
13 SASI_Hs01_00138398 predicted 321
14 SASI_Hs01_00138399 predicted 301
15 SASI_Hs01_00138400 predicted 1735
16 SASI_Hs01_00138401 predicted 1246
17 SASI_Hs01_00138402 predicted 337
18 SASI_Hs01_00138403 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006840
LILRB5 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006840.3-1289s21c1
Sequence:CCGGACCGATGCTACAGCGCAATCACTCGAGTGATTGCGCTGTAGCATCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1161s1c1
Sequence:CCGGGCTGTGTCTAAAGTCAAAGTACTCGAGTACTTTGACTTTAGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1618s1c1
Sequence:CCGGGCTGACATCCAGGAGGAAATTCTCGAGAATTTCCTCCTGGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-428s1c1
Sequence:CCGGTCTATGCAGAACCCACTCTTTCTCGAGAAAGAGTGGGTTCTGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-511s1c1
Sequence:CCGGGACGGACTTCTCACGTTTGTTCTCGAGAACAAACGTGAGAAGTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006840
LILRB5 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006840.3-1289s21c1
Sequence:CCGGACCGATGCTACAGCGCAATCACTCGAGTGATTGCGCTGTAGCATCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1161s1c1
Sequence:CCGGGCTGTGTCTAAAGTCAAAGTACTCGAGTACTTTGACTTTAGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1618s1c1
Sequence:CCGGGCTGACATCCAGGAGGAAATTCTCGAGAATTTCCTCCTGGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-428s1c1
Sequence:CCGGTCTATGCAGAACCCACTCTTTCTCGAGAAAGAGTGGGTTCTGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-511s1c1
Sequence:CCGGGACGGACTTCTCACGTTTGTTCTCGAGAACAAACGTGAGAAGTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006840
LILRB5 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006840.3-1289s21c1
Sequence:CCGGACCGATGCTACAGCGCAATCACTCGAGTGATTGCGCTGTAGCATCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1161s1c1
Sequence:CCGGGCTGTGTCTAAAGTCAAAGTACTCGAGTACTTTGACTTTAGACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-1618s1c1
Sequence:CCGGGCTGACATCCAGGAGGAAATTCTCGAGAATTTCCTCCTGGATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-428s1c1
Sequence:CCGGTCTATGCAGAACCCACTCTTTCTCGAGAAAGAGTGGGTTCTGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006840.2-511s1c1
Sequence:CCGGGACGGACTTCTCACGTTTGTTCTCGAGAACAAACGTGAGAAGTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)