EMAIL THIS PAGE TO A FRIEND

LILRP2

leukocyte immunoglobulin-like receptor pseudogene 2

66 Gene Product Result for
Synonyms: CD85m ILT10 LILRA5
Species: Human LILRP2(79166)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024317 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003061 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377959 predicted 1117
2 SASI_Hs02_00377960 predicted 3073
3 SASI_Hs02_00377961 predicted 1493
4 SASI_Hs02_00377962 predicted 595
5 SASI_Hs02_00377963 predicted 2989
6 SASI_Hs02_00377964 predicted 3296
7 SASI_Hs02_00377965 predicted 995
8 SASI_Hs02_00377966 predicted 1606
9 SASI_Hs02_00377967 predicted 2825
10 SASI_Hs02_00377968 predicted 3167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024317
LILRP2 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-543s1c1
Sequence:CCGGCCAGGGTTACTATCTCACCAACTCGAGTTGGTGAGATAGTAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-552s1c1
Sequence:CCGGCTATCTCACCAAGGAAGGAAACTCGAGTTTCCTTCCTTGGTGAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-825s1c1
Sequence:CCGGCTATGACAAATTCACTCTGTACTCGAGTACAGAGTGAATTTGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-1263s1c1
Sequence:CCGGCTACAGCTCACGCAGATTCTTCTCGAGAAGAATCTGCGTGAGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-606s1c1
Sequence:CCGGGCCCAGGAACAAGACCAACTTCTCGAGAAGTTGGTCTTGTTCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024317
LILRP2 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-543s1c1
Sequence:CCGGCCAGGGTTACTATCTCACCAACTCGAGTTGGTGAGATAGTAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-552s1c1
Sequence:CCGGCTATCTCACCAAGGAAGGAAACTCGAGTTTCCTTCCTTGGTGAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-825s1c1
Sequence:CCGGCTATGACAAATTCACTCTGTACTCGAGTACAGAGTGAATTTGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-1263s1c1
Sequence:CCGGCTACAGCTCACGCAGATTCTTCTCGAGAAGAATCTGCGTGAGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-606s1c1
Sequence:CCGGGCCCAGGAACAAGACCAACTTCTCGAGAAGTTGGTCTTGTTCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024317
LILRP2 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-543s1c1
Sequence:CCGGCCAGGGTTACTATCTCACCAACTCGAGTTGGTGAGATAGTAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-552s1c1
Sequence:CCGGCTATCTCACCAAGGAAGGAAACTCGAGTTTCCTTCCTTGGTGAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-825s1c1
Sequence:CCGGCTATGACAAATTCACTCTGTACTCGAGTACAGAGTGAATTTGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-1263s1c1
Sequence:CCGGCTACAGCTCACGCAGATTCTTCTCGAGAAGAATCTGCGTGAGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024317.2-606s1c1
Sequence:CCGGGCCCAGGAACAAGACCAACTTCTCGAGAAGTTGGTCTTGTTCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)