EMAIL THIS PAGE TO A FRIEND

LIM2

lens intrinsic membrane protein 2, 19kDa

50 Gene Product Result for
Synonyms: CTRCT19 MP17 MP19
UniProtKB ID: P55344, Q6B083, Q9BXD0, Q9HAR5
Gene ID:
Human(3982) Summary: This gene encodes an eye lens-specific protein found at the junctions of lens fiber cells, where it may contribute to cell junctional organization. It acts as a receptor for calmodulin, and may play an important role in both lens development and cataractogenesis. Mutations in this gene have been associated with cataract formation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(233187) lens intrinsic membrane protein 2
Rat(114903) lens intrinsic membrane protein 2
dog(611737) lens intrinsic membrane protein 2, 19kDa
domestic cat(101090816) lens intrinsic membrane protein 2, 19kDa
cow(281282) lens intrinsic membrane protein 2, 19kDa
domestic guinea pig(100170759) lens intrinsic membrane protein 2
naked mole-rat(101709483) lens intrinsic membrane protein 2, 19kDa
sheep(101110785) lens intrinsic membrane protein 2, 19kDa
Domestic Rabbit(100101575) lens intrinsic membrane protein 2, 19kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044461 MISSION® esiRNA esiRNA targeting mouse Lim2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030657 Rosetta Predictions human pricing
NM_053771 Rosetta Predictions rat pricing
NM_177693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106237 predicted 594
2 SASI_Hs02_00358233 predicted 265
3 SASI_Hs01_00106239 predicted 398
4 SASI_Hs01_00106240 predicted 338
5 SASI_Hs01_00106241 predicted 412
6 SASI_Hs02_00358234 predicted 400
7 SASI_Hs02_00358235 predicted 529
8 SASI_Hs01_00106242 predicted 434
9 SASI_Hs01_00106243 predicted 267
10 SASI_Hs01_00106244 predicted 487
11 SASI_Hs01_00106238 predicted 738
12 SASI_Hs01_00106245 predicted 364
13 SASI_Hs01_00106246 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101664 predicted 588
2 SASI_Rn01_00101665 predicted 574
3 SASI_Rn02_00266569 predicted 333
4 SASI_Rn01_00101667 predicted 519
5 SASI_Rn01_00101668 predicted 204
6 SASI_Rn02_00266570 predicted 572
7 SASI_Rn01_00101670 predicted 485
8 SASI_Rn01_00101671 predicted 204
9 SASI_Rn01_00101672 predicted 261
10 SASI_Rn01_00101673 predicted 226
11 SASI_Rn01_00101666 predicted 384
12 SASI_Rn01_00101669 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132720 predicted 607
2 SASI_Mm01_00132721 predicted 398
3 SASI_Mm01_00132722 predicted 531
4 SASI_Mm01_00132723 predicted 200
5 SASI_Mm01_00132724 predicted 289
6 SASI_Mm01_00132725 predicted 278
7 SASI_Mm01_00132726 predicted 285
8 SASI_Mm01_00132727 predicted 643
9 SASI_Mm01_00132728 predicted 348
10 SASI_Mm01_00132729 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030657
LIM2 MISSION shRNA Bacterial Glycerol Stock
lens intrinsic membrane protein 2, 19kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030657.2-694s1c1
Sequence:CCGGCCCAACTTCATCTGGAAGTTACTCGAGTAACTTCCAGATGAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-323s1c1
Sequence:CCGGGCAACCCAAGCATACTGGAATCTCGAGATTCCAGTATGCTTGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-385s1c1
Sequence:CCGGCTCCGGCATCATCATGGGCATCTCGAGATGCCCATGATGATGCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-97s1c1
Sequence:CCGGCATGGCAACAGACCACTGGATCTCGAGATCCAGTGGTCTGTTGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-603s1c1
Sequence:CCGGTGACGTTCTTCGCAGGGATTTCTCGAGAAATCCCTGCGAAGAACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-371s21c1
Sequence:CCGGCATGATCCTGTCTGCCCTATGCTCGAGCATAGGGCAGACAGGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030657.3-801s21c1
Sequence:CCGGCAGTTCTGGACTGTGGGTTTGCTCGAGCAAACCCACAGTCCAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-294s21c1
Sequence:CCGGTATTCCAGATGGAGAACTCTGCTCGAGCAGAGTTCTCCATCTGGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-510s21c1
Sequence:CCGGTTGGCCTTGGCCATCTACACTCTCGAGAGTGTAGATGGCCAAGGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030657
LIM2 MISSION shRNA shRNA Plasmid DNA
lens intrinsic membrane protein 2, 19kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030657.2-694s1c1
Sequence:CCGGCCCAACTTCATCTGGAAGTTACTCGAGTAACTTCCAGATGAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-323s1c1
Sequence:CCGGGCAACCCAAGCATACTGGAATCTCGAGATTCCAGTATGCTTGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-385s1c1
Sequence:CCGGCTCCGGCATCATCATGGGCATCTCGAGATGCCCATGATGATGCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-97s1c1
Sequence:CCGGCATGGCAACAGACCACTGGATCTCGAGATCCAGTGGTCTGTTGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-603s1c1
Sequence:CCGGTGACGTTCTTCGCAGGGATTTCTCGAGAAATCCCTGCGAAGAACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-371s21c1
Sequence:CCGGCATGATCCTGTCTGCCCTATGCTCGAGCATAGGGCAGACAGGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030657.3-801s21c1
Sequence:CCGGCAGTTCTGGACTGTGGGTTTGCTCGAGCAAACCCACAGTCCAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-294s21c1
Sequence:CCGGTATTCCAGATGGAGAACTCTGCTCGAGCAGAGTTCTCCATCTGGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-510s21c1
Sequence:CCGGTTGGCCTTGGCCATCTACACTCTCGAGAGTGTAGATGGCCAAGGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030657
LIM2 MISSION shRNA Lentiviral Transduction Particles
lens intrinsic membrane protein 2, 19kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030657.2-694s1c1
Sequence:CCGGCCCAACTTCATCTGGAAGTTACTCGAGTAACTTCCAGATGAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-323s1c1
Sequence:CCGGGCAACCCAAGCATACTGGAATCTCGAGATTCCAGTATGCTTGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-385s1c1
Sequence:CCGGCTCCGGCATCATCATGGGCATCTCGAGATGCCCATGATGATGCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-97s1c1
Sequence:CCGGCATGGCAACAGACCACTGGATCTCGAGATCCAGTGGTCTGTTGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030657.2-603s1c1
Sequence:CCGGTGACGTTCTTCGCAGGGATTTCTCGAGAAATCCCTGCGAAGAACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-371s21c1
Sequence:CCGGCATGATCCTGTCTGCCCTATGCTCGAGCATAGGGCAGACAGGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030657.3-801s21c1
Sequence:CCGGCAGTTCTGGACTGTGGGTTTGCTCGAGCAAACCCACAGTCCAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-294s21c1
Sequence:CCGGTATTCCAGATGGAGAACTCTGCTCGAGCAGAGTTCTCCATCTGGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030657.3-510s21c1
Sequence:CCGGTTGGCCTTGGCCATCTACACTCTCGAGAGTGTAGATGGCCAAGGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177693
LIM2 MISSION shRNA Bacterial Glycerol Stock
lens intrinsic membrane protein 2, 19kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177693.2-612s1c1
Sequence:CCGGAGTTACAGTGAGGGCACTGAACTCGAGTTCAGTGCCCTCACTGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-406s1c1
Sequence:CCGGGCCTTGGCTATTTACACTGGACTCGAGTCCAGTGTAAATAGCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-116s1c1
Sequence:CCGGTGTTGGTGGTAGCCACAGCAACTCGAGTTGCTGTGGCTACCACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-222s1c1
Sequence:CCGGGCAGACCGAGAGCATCGCATACTCGAGTATGCGATGCTCTCGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-228s1c1
Sequence:CCGGCGAGAGCATCGCATATTGGAACTCGAGTTCCAATATGCGATGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177693
LIM2 MISSION shRNA shRNA Plasmid DNA
lens intrinsic membrane protein 2, 19kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177693.2-612s1c1
Sequence:CCGGAGTTACAGTGAGGGCACTGAACTCGAGTTCAGTGCCCTCACTGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-406s1c1
Sequence:CCGGGCCTTGGCTATTTACACTGGACTCGAGTCCAGTGTAAATAGCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-116s1c1
Sequence:CCGGTGTTGGTGGTAGCCACAGCAACTCGAGTTGCTGTGGCTACCACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-222s1c1
Sequence:CCGGGCAGACCGAGAGCATCGCATACTCGAGTATGCGATGCTCTCGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-228s1c1
Sequence:CCGGCGAGAGCATCGCATATTGGAACTCGAGTTCCAATATGCGATGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177693
LIM2 MISSION shRNA Lentiviral Transduction Particles
lens intrinsic membrane protein 2, 19kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177693.2-612s1c1
Sequence:CCGGAGTTACAGTGAGGGCACTGAACTCGAGTTCAGTGCCCTCACTGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-406s1c1
Sequence:CCGGGCCTTGGCTATTTACACTGGACTCGAGTCCAGTGTAAATAGCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-116s1c1
Sequence:CCGGTGTTGGTGGTAGCCACAGCAACTCGAGTTGCTGTGGCTACCACCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-222s1c1
Sequence:CCGGGCAGACCGAGAGCATCGCATACTCGAGTATGCGATGCTCTCGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177693.2-228s1c1
Sequence:CCGGCGAGAGCATCGCATATTGGAACTCGAGTTCCAATATGCGATGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)