EMAIL THIS PAGE TO A FRIEND

LIMA1

LIM domain and actin binding 1

147 Gene Product Result for
Synonyms: EPLIN SREBP3
Gene ID:
Human(51474) Summary: This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Mouse(65970) LIM domain and actin binding 1
Rat(300228) LIM domain and actin binding 1
Zebrafish(64000) LIM domain and actin binding 1
chicken(426878) LIM domain and actin binding 1
dog(477610) LIM domain and actin binding 1
domestic cat(101087494) LIM domain and actin binding 1
cow(540637) LIM domain and actin binding 1
Horse(100060033) LIM domain and actin binding 1
sheep(101118861) LIM domain and actin binding 1
Domestic Rabbit(100358600) LIM domain and actin binding 1
domestic guinea pig(100719809) LIM domain and actin binding 1
naked mole-rat(101699076) LIM domain and actin binding 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113546 Rosetta Predictions human pricing
NM_001113547 Rosetta Predictions human pricing
NM_016357 Rosetta Predictions human pricing
XM_001064221 Rosetta Predictions rat pricing
XM_217039 Rosetta Predictions rat pricing
NM_001113545 Rosetta Predictions mouse pricing
NM_023063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326061 predicted 1435
2 SASI_Hs02_00326062 predicted 2284
3 SASI_Hs02_00326063 predicted 1927
4 SASI_Hs02_00326064 predicted 1402
5 SASI_Hs02_00326065 predicted 1473
6 SASI_Hs02_00326066 predicted 1937
7 SASI_Hs02_00326067 predicted 2266
8 SASI_Hs02_00326068 predicted 1896
9 SASI_Hs02_00326069 predicted 1502
10 SASI_Hs02_00326070 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326071 predicted 1320
2 SASI_Hs02_00326072 predicted 2162
3 SASI_Hs02_00326073 predicted 1805
4 SASI_Hs02_00326074 predicted 1283
5 SASI_Hs02_00326075 predicted 1358
6 SASI_Hs02_00326076 predicted 1822
7 SASI_Hs02_00326077 predicted 2147
8 SASI_Hs02_00326078 predicted 1774
9 SASI_Hs02_00326079 predicted 1380
10 SASI_Hs02_00326080 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086640 predicted 1438
2 SASI_Hs02_00349329 predicted 2282
3 SASI_Hs01_00086641 predicted 1927
4 SASI_Hs01_00086645 predicted 1470
5 SASI_Hs02_00349330 predicted 2233
6 SASI_Hs01_00086646 predicted 1933
7 SASI_Hs01_00086647 predicted 2267
8 SASI_Hs01_00086649 predicted 1894
9 SASI_Hs02_00349331 predicted 1494
10 SASI_Hs02_00349332 predicted 882
11 SASI_Hs01_00086642 predicted 1175
12 SASI_Hs01_00086643 predicted 1323
13 SASI_Hs01_00086644 predicted 1129
14 SASI_Hs01_00086648 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309717 predicted 248
2 SASI_Rn02_00309718 predicted 1306
3 SASI_Rn02_00309719 predicted 1636
4 SASI_Rn02_00309720 predicted 1365
5 SASI_Rn02_00309721 predicted 1380
6 SASI_Rn02_00309722 predicted 1209
7 SASI_Rn02_00309723 predicted 780
8 SASI_Rn02_00309724 predicted 658
9 SASI_Rn02_00309725 predicted 1300
10 SASI_Rn02_00309726 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376980 predicted 648
2 SASI_Rn02_00376981 predicted 253
3 SASI_Rn02_00376982 predicted 249
4 SASI_Rn02_00376983 predicted 340
5 SASI_Rn02_00376984 predicted 671
6 SASI_Rn02_00376985 predicted 570
7 SASI_Rn02_00376986 predicted 767
8 SASI_Rn02_00376987 predicted 783
9 SASI_Rn02_00376988 predicted 784
10 SASI_Rn02_00376989 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308113 predicted 1371
2 SASI_Mm02_00308114 predicted 1453
3 SASI_Mm02_00308115 predicted 1908
4 SASI_Mm02_00308116 predicted 1437
5 SASI_Mm02_00308117 predicted 584
6 SASI_Mm02_00308118 predicted 855
7 SASI_Mm02_00308119 predicted 1287
8 SASI_Mm02_00308120 predicted 1434
9 SASI_Mm02_00308121 predicted 1443
10 SASI_Mm02_00308122 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326771 predicted 1240
2 SASI_Mm02_00326772 predicted 1315
3 SASI_Mm02_00326773 predicted 1778
4 SASI_Mm02_00326774 predicted 1304
5 SASI_Mm02_00326775 predicted 719
6 SASI_Mm02_00326776 predicted 1146
7 SASI_Mm02_00326777 predicted 522
8 SASI_Mm02_00326778 predicted 1294
9 SASI_Mm02_00326779 predicted 1315
10 SASI_Mm02_00326780 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023063
VALIDATED
LIMA1 MISSION shRNA Bacterial Glycerol Stock
LIM domain and actin binding 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2666s21c1
Sequence:CCGGGAAGGGCTAAGTAGGGATTTCCTCGAGGAAATCCCTACTTAGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-2238s21c1
Sequence:CCGGTAAAGAGAAACCGGTACTATGCTCGAGCATAGTACCGGTTTCTCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2376s21c1
Sequence:CCGGATTCATGTGGGAGCAACTTTGCTCGAGCAAAGTTGCTCCCACATGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-866s21c1
Sequence:CCGGAGCCCAGCCAGCTACACAAATCTCGAGATTTGTGTAGCTGGCTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-1362s21c1
Sequence:CCGGGCAACTATGACGAGGGCTTTGCTCGAGCAAAGCCCTCGTCATAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2333s21c1
Sequence:CCGGTATCAAGTGGTGCGCAGAAACCTCGAGGTTTCTGCGCACCACTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-3060s1c1
Sequence:CCGGCCCATCATCAACAATAAGAAACTCGAGTTTCTTATTGTTGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1260s1c1
Sequence:CCGGGCCTCACTTCAATCAACTCTTCTCGAGAAGAGTTGATTGAAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1832s1c1
Sequence:CCGGCGACGATGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-538s1c1
Sequence:CCGGCTGAAGATGATGTTTGAGAAACTCGAGTTTCTCAAACATCATCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1054s1c1
Sequence:CCGGCCGGAAAGTTCTCCTTCCAAACTCGAGTTTGGAAGGAGAACTTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023063
VALIDATED
LIMA1 MISSION shRNA shRNA Plasmid DNA
LIM domain and actin binding 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2666s21c1
Sequence:CCGGGAAGGGCTAAGTAGGGATTTCCTCGAGGAAATCCCTACTTAGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-2238s21c1
Sequence:CCGGTAAAGAGAAACCGGTACTATGCTCGAGCATAGTACCGGTTTCTCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2376s21c1
Sequence:CCGGATTCATGTGGGAGCAACTTTGCTCGAGCAAAGTTGCTCCCACATGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-866s21c1
Sequence:CCGGAGCCCAGCCAGCTACACAAATCTCGAGATTTGTGTAGCTGGCTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-1362s21c1
Sequence:CCGGGCAACTATGACGAGGGCTTTGCTCGAGCAAAGCCCTCGTCATAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2333s21c1
Sequence:CCGGTATCAAGTGGTGCGCAGAAACCTCGAGGTTTCTGCGCACCACTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-3060s1c1
Sequence:CCGGCCCATCATCAACAATAAGAAACTCGAGTTTCTTATTGTTGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1260s1c1
Sequence:CCGGGCCTCACTTCAATCAACTCTTCTCGAGAAGAGTTGATTGAAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1832s1c1
Sequence:CCGGCGACGATGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-538s1c1
Sequence:CCGGCTGAAGATGATGTTTGAGAAACTCGAGTTTCTCAAACATCATCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1054s1c1
Sequence:CCGGCCGGAAAGTTCTCCTTCCAAACTCGAGTTTGGAAGGAGAACTTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023063
VALIDATED
LIMA1 MISSION shRNA Lentiviral Transduction Particles
LIM domain and actin binding 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2666s21c1
Sequence:CCGGGAAGGGCTAAGTAGGGATTTCCTCGAGGAAATCCCTACTTAGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-2238s21c1
Sequence:CCGGTAAAGAGAAACCGGTACTATGCTCGAGCATAGTACCGGTTTCTCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2376s21c1
Sequence:CCGGATTCATGTGGGAGCAACTTTGCTCGAGCAAAGTTGCTCCCACATGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-866s21c1
Sequence:CCGGAGCCCAGCCAGCTACACAAATCTCGAGATTTGTGTAGCTGGCTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023063.3-1362s21c1
Sequence:CCGGGCAACTATGACGAGGGCTTTGCTCGAGCAAAGCCCTCGTCATAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023063.3-2333s21c1
Sequence:CCGGTATCAAGTGGTGCGCAGAAACCTCGAGGTTTCTGCGCACCACTTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-3060s1c1
Sequence:CCGGCCCATCATCAACAATAAGAAACTCGAGTTTCTTATTGTTGATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1260s1c1
Sequence:CCGGGCCTCACTTCAATCAACTCTTCTCGAGAAGAGTTGATTGAAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1832s1c1
Sequence:CCGGCGACGATGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-538s1c1
Sequence:CCGGCTGAAGATGATGTTTGAGAAACTCGAGTTTCTCAAACATCATCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023063.1-1054s1c1
Sequence:CCGGCCGGAAAGTTCTCCTTCCAAACTCGAGTTTGGAAGGAGAACTTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016357
VALIDATED
LIMA1 MISSION shRNA Bacterial Glycerol Stock
LIM domain and actin binding 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2461s21c1
Sequence:CCGGGCAATGATGCTGGGCCTTAAACTCGAGTTTAAGGCCCAGCATCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-1957s21c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-321s21c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2283s21c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-957s21c1
Sequence:CCGGCCTCTCAGAAACCTCTATAAACTCGAGTTTATAGAGGTTTCTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-2210s1c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016357.1-2022s1c1
Sequence:CCGGGCTTCTAAGAAGAATGGGAATCTCGAGATTCCCATTCTTCTTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-248s1c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-1884s1c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016357
VALIDATED
LIMA1 MISSION shRNA shRNA Plasmid DNA
LIM domain and actin binding 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2461s21c1
Sequence:CCGGGCAATGATGCTGGGCCTTAAACTCGAGTTTAAGGCCCAGCATCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-1957s21c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-321s21c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2283s21c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-957s21c1
Sequence:CCGGCCTCTCAGAAACCTCTATAAACTCGAGTTTATAGAGGTTTCTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-2210s1c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016357.1-2022s1c1
Sequence:CCGGGCTTCTAAGAAGAATGGGAATCTCGAGATTCCCATTCTTCTTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-248s1c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-1884s1c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016357
VALIDATED
LIMA1 MISSION shRNA Lentiviral Transduction Particles
LIM domain and actin binding 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2461s21c1
Sequence:CCGGGCAATGATGCTGGGCCTTAAACTCGAGTTTAAGGCCCAGCATCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-1957s21c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-321s21c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-2283s21c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016357.4-957s21c1
Sequence:CCGGCCTCTCAGAAACCTCTATAAACTCGAGTTTATAGAGGTTTCTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-2210s1c1
Sequence:CCGGGTCTCTGAATTGGTCGAGTTTCTCGAGAAACTCGACCAATTCAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016357.1-2022s1c1
Sequence:CCGGGCTTCTAAGAAGAATGGGAATCTCGAGATTCCCATTCTTCTTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-248s1c1
Sequence:CCGGCATGGAGAAGAAGAGAAGTAACTCGAGTTACTTCTCTTCTTCTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016357.1-1884s1c1
Sequence:CCGGGCTTCATTTCAAAGCACCTCTCTCGAGAGAGGTGCTTTGAAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)