EMAIL THIS PAGE TO A FRIEND

LIMCH1

LIM and calponin homology domains 1

107 Gene Product Result for
Synonyms: LIMCH1A LMO7B
Gene ID:
Mouse(77569) LIM and calponin homology domains 1
Rat(305332) LIM and calponin homology domains 1
chicken(422780) LIM and calponin homology domains 1
cow(535165) LIM and calponin homology domains 1
Horse(100063373) LIM and calponin homology domains 1
domestic cat(101101051) LIM and calponin homology domains 1
dog(475135) LIM and calponin homology domains 1
domestic guinea pig(100715144) LIM and calponin homology domains 1
naked mole-rat(101699932) LIM and calponin homology domains 1
sheep(101117845) LIM and calponin homology domains 1
Domestic Rabbit(100358586) LIM and calponin homology domains 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014988 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112717 Rosetta Predictions human pricing
NM_001112718 Rosetta Predictions human pricing
NM_001112719 Rosetta Predictions human pricing
NM_001112720 Rosetta Predictions human pricing
NM_014988 Rosetta Predictions human pricing
XM_001077838 Rosetta Predictions rat pricing
XM_223397 Rosetta Predictions rat pricing
NM_001001980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325435 predicted 2684
2 SASI_Hs02_00325436 predicted 1542
3 SASI_Hs02_00325437 predicted 2668
4 SASI_Hs02_00325438 predicted 2763
5 SASI_Hs02_00325439 predicted 1571
6 SASI_Hs02_00325440 predicted 1453
7 SASI_Hs02_00325441 predicted 1704
8 SASI_Hs02_00325442 predicted 2104
9 SASI_Hs02_00325443 predicted 1999
10 SASI_Hs02_00325444 predicted 2619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325445 predicted 2679
2 SASI_Hs02_00325446 predicted 1542
3 SASI_Hs02_00325447 predicted 2661
4 SASI_Hs02_00325448 predicted 2761
5 SASI_Hs02_00325449 predicted 1566
6 SASI_Hs02_00325450 predicted 1459
7 SASI_Hs02_00325451 predicted 1711
8 SASI_Hs02_00325452 predicted 2105
9 SASI_Hs02_00325453 predicted 2000
10 SASI_Hs02_00325454 predicted 2618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325455 predicted 2338
2 SASI_Hs02_00325456 predicted 1195
3 SASI_Hs02_00325457 predicted 2323
4 SASI_Hs02_00325458 predicted 2412
5 SASI_Hs02_00325459 predicted 1222
6 SASI_Hs02_00325460 predicted 1109
7 SASI_Hs02_00325461 predicted 1368
8 SASI_Hs02_00325462 predicted 1761
9 SASI_Hs02_00325463 predicted 1659
10 SASI_Hs02_00325464 predicted 2274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325465 predicted 2302
2 SASI_Hs02_00325466 predicted 1163
3 SASI_Hs02_00325467 predicted 2285
4 SASI_Hs02_00325468 predicted 2380
5 SASI_Hs02_00325469 predicted 1190
6 SASI_Hs02_00325470 predicted 1073
7 SASI_Hs02_00325471 predicted 1331
8 SASI_Hs02_00325472 predicted 1720
9 SASI_Hs02_00325473 predicted 1620
10 SASI_Hs02_00325474 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346741 predicted 2683
2 SASI_Hs02_00346742 predicted 1537
3 SASI_Hs02_00346743 predicted 2670
4 SASI_Hs02_00346744 predicted 2767
5 SASI_Hs02_00346745 predicted 1570
6 SASI_Hs02_00346746 predicted 1455
7 SASI_Hs01_00118045 predicted 1711
8 SASI_Hs02_00346747 predicted 2103
9 SASI_Hs02_00346748 predicted 1996
10 SASI_Hs02_00346749 predicted 2618
11 SASI_Hs01_00118038 predicted 328
12 SASI_Hs01_00118039 predicted 2267
13 SASI_Hs01_00118040 predicted 1696
14 SASI_Hs01_00118041 predicted 830
15 SASI_Hs01_00118042 predicted 2953
16 SASI_Hs01_00118043 predicted 489
17 SASI_Hs01_00118044 predicted 2312
18 SASI_Hs01_00118046 predicted 370
19 SASI_Hs01_00118047 predicted 2703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358702 predicted 830
2 SASI_Rn02_00358703 predicted 3540
3 SASI_Rn02_00358704 predicted 2991
4 SASI_Rn02_00358705 predicted 1203
5 SASI_Rn02_00358706 predicted 699
6 SASI_Rn02_00358707 predicted 1911
7 SASI_Rn02_00358708 predicted 3524
8 SASI_Rn02_00358709 predicted 575
9 SASI_Rn02_00358710 predicted 1172
10 SASI_Rn02_00358711 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381325 predicted 833
2 SASI_Rn02_00381326 predicted 3540
3 SASI_Rn02_00381327 predicted 2993
4 SASI_Rn02_00381328 predicted 1206
5 SASI_Rn02_00381329 predicted 699
6 SASI_Rn02_00381330 predicted 1910
7 SASI_Rn02_00381331 predicted 3526
8 SASI_Rn02_00381332 predicted 574
9 SASI_Rn02_00381333 predicted 1171
10 SASI_Rn02_00381334 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023177 predicted 2183
2 SASI_Mm01_00023178 predicted 2346
3 SASI_Mm01_00023180 predicted 2276
4 SASI_Mm01_00023182 predicted 403
5 SASI_Mm01_00023183 predicted 3175
6 SASI_Mm01_00023184 predicted 330
7 SASI_Mm01_00023185 predicted 1555
8 SASI_Mm01_00023186 predicted 2891
9 SASI_Mm02_00286239 predicted 347
10 SASI_Mm02_00286240 predicted 770
11 SASI_Mm01_00023179 predicted 1892
12 SASI_Mm01_00023181 predicted 2103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014988
VALIDATED
LIMCH1 MISSION shRNA Bacterial Glycerol Stock
LIM and calponin homology domains 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1325s21c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-2309s1c1
Sequence:CCGGGCAGTGAGAAGTCACCTGTTACTCGAGTAACAGGTGACTTCTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3138s1c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1555s21c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-3138s21c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1460s21c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3246s1c1
Sequence:CCGGCCTGAACTGTAATGATTGCTACTCGAGTAGCAATCATTACAGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014988.1-4225s1c1
Sequence:CCGGGCACCGAGATAAGTTCATCATCTCGAGATGATGAACTTATCTCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1460s1c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-4412s1c1
Sequence:CCGGGCCCACTTCAATGAATACCTACTCGAGTAGGTATTCATTGAAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3324s1c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1325s1c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1555s1c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014988.1-278s1c1
Sequence:CCGGCCATTGCAGGACTGGACAATACTCGAGTATTGTCCAGTCCTGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1881s1c1
Sequence:CCGGCGGTAGCATCGAGATCAACATCTCGAGATGTTGATCTCGATGCTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014988.2-3324s21c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014988
VALIDATED
LIMCH1 MISSION shRNA shRNA Plasmid DNA
LIM and calponin homology domains 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1325s21c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-2309s1c1
Sequence:CCGGGCAGTGAGAAGTCACCTGTTACTCGAGTAACAGGTGACTTCTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3138s1c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1555s21c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-3138s21c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1460s21c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3246s1c1
Sequence:CCGGCCTGAACTGTAATGATTGCTACTCGAGTAGCAATCATTACAGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014988.1-4225s1c1
Sequence:CCGGGCACCGAGATAAGTTCATCATCTCGAGATGATGAACTTATCTCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1460s1c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-4412s1c1
Sequence:CCGGGCCCACTTCAATGAATACCTACTCGAGTAGGTATTCATTGAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3324s1c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1325s1c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1555s1c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014988.1-278s1c1
Sequence:CCGGCCATTGCAGGACTGGACAATACTCGAGTATTGTCCAGTCCTGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1881s1c1
Sequence:CCGGCGGTAGCATCGAGATCAACATCTCGAGATGTTGATCTCGATGCTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014988.2-3324s21c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014988
VALIDATED
LIMCH1 MISSION shRNA Lentiviral Transduction Particles
LIM and calponin homology domains 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1325s21c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-2309s1c1
Sequence:CCGGGCAGTGAGAAGTCACCTGTTACTCGAGTAACAGGTGACTTCTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3138s1c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1555s21c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-3138s21c1
Sequence:CCGGCGAGACCCTCAATCTCTATTTCTCGAGAAATAGAGATTGAGGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014988.2-1460s21c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3246s1c1
Sequence:CCGGCCTGAACTGTAATGATTGCTACTCGAGTAGCAATCATTACAGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014988.1-4225s1c1
Sequence:CCGGGCACCGAGATAAGTTCATCATCTCGAGATGATGAACTTATCTCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1460s1c1
Sequence:CCGGGCCATTCAACAGAGCCAAATTCTCGAGAATTTGGCTCTGTTGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-4412s1c1
Sequence:CCGGGCCCACTTCAATGAATACCTACTCGAGTAGGTATTCATTGAAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-3324s1c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1325s1c1
Sequence:CCGGGAGAGCTGCATGAAGCATATACTCGAGTATATGCTTCATGCAGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1555s1c1
Sequence:CCGGGCCACTGTTGAAACCACCATTCTCGAGAATGGTGGTTTCAACAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014988.1-278s1c1
Sequence:CCGGCCATTGCAGGACTGGACAATACTCGAGTATTGTCCAGTCCTGCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014988.1-1881s1c1
Sequence:CCGGCGGTAGCATCGAGATCAACATCTCGAGATGTTGATCTCGATGCTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014988.2-3324s21c1
Sequence:CCGGCGGATCACTCACCATTTCTTTCTCGAGAAAGAAATGGTGAGTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001980
VALIDATED
LIMCH1 MISSION shRNA Bacterial Glycerol Stock
LIM and calponin homology domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001980.1-501s1c1
Sequence:CCGGCCATTGCAGGATTGGACAATACTCGAGTATTGTCCAATCCTGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-3400s1c1
Sequence:CCGGCCGGAGACATTTGTGTTACTTCTCGAGAAGTAACACAAATGTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-1923s1c1
Sequence:CCGGCGGATTCTCCAAGCAGTGAAACTCGAGTTTCACTGCTTGGAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-241s1c1
Sequence:CCGGGAGCACGAGTATGTTTGACATCTCGAGATGTCAAACATACTCGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-2392s1c1
Sequence:CCGGCCCTGAAATCTCCGTGTCAAACTCGAGTTTGACACGGAGATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001980
VALIDATED
LIMCH1 MISSION shRNA shRNA Plasmid DNA
LIM and calponin homology domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001980.1-501s1c1
Sequence:CCGGCCATTGCAGGATTGGACAATACTCGAGTATTGTCCAATCCTGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-3400s1c1
Sequence:CCGGCCGGAGACATTTGTGTTACTTCTCGAGAAGTAACACAAATGTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-1923s1c1
Sequence:CCGGCGGATTCTCCAAGCAGTGAAACTCGAGTTTCACTGCTTGGAGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-241s1c1
Sequence:CCGGGAGCACGAGTATGTTTGACATCTCGAGATGTCAAACATACTCGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-2392s1c1
Sequence:CCGGCCCTGAAATCTCCGTGTCAAACTCGAGTTTGACACGGAGATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001980
VALIDATED
LIMCH1 MISSION shRNA Lentiviral Transduction Particles
LIM and calponin homology domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001980.1-501s1c1
Sequence:CCGGCCATTGCAGGATTGGACAATACTCGAGTATTGTCCAATCCTGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-3400s1c1
Sequence:CCGGCCGGAGACATTTGTGTTACTTCTCGAGAAGTAACACAAATGTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-1923s1c1
Sequence:CCGGCGGATTCTCCAAGCAGTGAAACTCGAGTTTCACTGCTTGGAGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-241s1c1
Sequence:CCGGGAGCACGAGTATGTTTGACATCTCGAGATGTCAAACATACTCGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001980.1-2392s1c1
Sequence:CCGGCCCTGAAATCTCCGTGTCAAACTCGAGTTTGACACGGAGATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)