EMAIL THIS PAGE TO A FRIEND

LIMD1

LIM domains containing 1

38 Gene Product Result for
UniProtKB ID: Q9UGP4, Q17RQ1, Q9BQQ9, Q9NQ47
Gene ID:
Mouse(29806) LIM domains containing 1
Rat(316101) LIM domains containing 1
chicken(420701) LIM domains containing 1
dog(484796) LIM domains containing 1
domestic cat(101092500) LIM domains containing 1
cow(617525) LIM domains containing 1
sheep(101119260) LIM domains containing 1
Domestic Rabbit(100351579) LIM domains containing 1
domestic guinea pig(100714516) LIM domains containing 1
naked mole-rat(101699485) LIM domains containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009561 MISSION® esiRNA esiRNA targeting human LIMD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014240 Rosetta Predictions human pricing
NM_001112737 Rosetta Predictions rat pricing
NM_013860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095038 predicted 966
2 SASI_Hs01_00095039 predicted 1762
3 SASI_Hs01_00095040 predicted 582
4 SASI_Hs02_00345281 predicted 1935
5 SASI_Hs01_00095041 predicted 829
6 SASI_Hs01_00095043 predicted 561
7 SASI_Hs01_00095044 predicted 1008
8 SASI_Hs01_00095045 predicted 795
9 SASI_Hs01_00095046 predicted 814
10 SASI_Hs01_00095047 predicted 1610
11 SASI_Hs01_00095042 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251620 predicted 891
2 SASI_Rn02_00251621 predicted 495
3 SASI_Rn02_00251622 predicted 411
4 SASI_Rn02_00251623 predicted 2176
5 SASI_Rn02_00251624 predicted 1502
6 SASI_Rn02_00251625 predicted 1518
7 SASI_Rn02_00251626 predicted 907
8 SASI_Rn02_00251627 predicted 1001
9 SASI_Rn02_00251628 predicted 969
10 SASI_Rn02_00251629 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130192 predicted 2043
2 SASI_Mm01_00130193 predicted 1034
3 SASI_Mm01_00130194 predicted 1687
4 SASI_Mm01_00130195 predicted 1047
5 SASI_Mm01_00130196 predicted 2017
6 SASI_Mm01_00130197 predicted 551
7 SASI_Mm01_00130198 predicted 1652
8 SASI_Mm01_00130199 predicted 1435
9 SASI_Mm01_00130200 predicted 1978
10 SASI_Mm01_00130201 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014240
VALIDATED
LIMD1 MISSION shRNA Bacterial Glycerol Stock
LIM domains containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1795s21c1
Sequence:CCGGGATCTACTGTGTCCGAGATTACTCGAGTAATCTCGGACACAGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-567s21c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1437s21c1
Sequence:CCGGACCCGAAGGCTGATTACTTTGCTCGAGCAAAGTAATCAGCCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-2248s21c1
Sequence:CCGGTACCTGCCTCCTGCGTGTATTCTCGAGAATACACGCAGGAGGCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1967s21c1
Sequence:CCGGGAAGATGGCCACCGCTGTTATCTCGAGATAACAGCGGTGGCCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014240.1-539s1c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1351s1c1
Sequence:CCGGGCTGCTGAGTTGAAATTAGAACTCGAGTTCTAATTTCAACTCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1206s1c1
Sequence:CCGGCCTGCCTGAGTTATCTTGTAACTCGAGTTACAAGATAACTCAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1043s1c1
Sequence:CCGGCCAAATCTTACCTTTCCAGTTCTCGAGAACTGGAAAGGTAAGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1709s1c1
Sequence:CCGGGTGTCATCTGTAATGAGTGTTCTCGAGAACACTCATTACAGATGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014240
VALIDATED
LIMD1 MISSION shRNA shRNA Plasmid DNA
LIM domains containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1795s21c1
Sequence:CCGGGATCTACTGTGTCCGAGATTACTCGAGTAATCTCGGACACAGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-567s21c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1437s21c1
Sequence:CCGGACCCGAAGGCTGATTACTTTGCTCGAGCAAAGTAATCAGCCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-2248s21c1
Sequence:CCGGTACCTGCCTCCTGCGTGTATTCTCGAGAATACACGCAGGAGGCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1967s21c1
Sequence:CCGGGAAGATGGCCACCGCTGTTATCTCGAGATAACAGCGGTGGCCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014240.1-539s1c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1351s1c1
Sequence:CCGGGCTGCTGAGTTGAAATTAGAACTCGAGTTCTAATTTCAACTCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1206s1c1
Sequence:CCGGCCTGCCTGAGTTATCTTGTAACTCGAGTTACAAGATAACTCAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1043s1c1
Sequence:CCGGCCAAATCTTACCTTTCCAGTTCTCGAGAACTGGAAAGGTAAGATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1709s1c1
Sequence:CCGGGTGTCATCTGTAATGAGTGTTCTCGAGAACACTCATTACAGATGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014240
VALIDATED
LIMD1 MISSION shRNA Lentiviral Transduction Particles
LIM domains containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1795s21c1
Sequence:CCGGGATCTACTGTGTCCGAGATTACTCGAGTAATCTCGGACACAGTAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-567s21c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1437s21c1
Sequence:CCGGACCCGAAGGCTGATTACTTTGCTCGAGCAAAGTAATCAGCCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-2248s21c1
Sequence:CCGGTACCTGCCTCCTGCGTGTATTCTCGAGAATACACGCAGGAGGCAGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014240.2-1967s21c1
Sequence:CCGGGAAGATGGCCACCGCTGTTATCTCGAGATAACAGCGGTGGCCATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014240.1-539s1c1
Sequence:CCGGGCCTCACTCATGGAGACTATTCTCGAGAATAGTCTCCATGAGTGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1351s1c1
Sequence:CCGGGCTGCTGAGTTGAAATTAGAACTCGAGTTCTAATTTCAACTCAGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1206s1c1
Sequence:CCGGCCTGCCTGAGTTATCTTGTAACTCGAGTTACAAGATAACTCAGGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1043s1c1
Sequence:CCGGCCAAATCTTACCTTTCCAGTTCTCGAGAACTGGAAAGGTAAGATTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014240.1-1709s1c1
Sequence:CCGGGTGTCATCTGTAATGAGTGTTCTCGAGAACACTCATTACAGATGACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013860
VALIDATED
LIMD1 MISSION shRNA Bacterial Glycerol Stock
LIM domains containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-570s21c1
Sequence:CCGGTCGAGGACCTGAACATGTATGCTCGAGCATACATGTTCAGGTCCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-1661s21c1
Sequence:CCGGAGTAACGTCCATCCGGTAATGCTCGAGCATTACCGGATGGACGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013860.1-3347s21c1
Sequence:CCGGGTCACCTTGTTCAACTCATTTCTCGAGAAATGAGTTGAACAAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013860.1-1031s21c1
Sequence:CCGGCTCACTCACGGAGACTATTATCTCGAGATAATAGTCTCCGTGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-4031s1c1
Sequence:CCGGCCCAGCATTGAAGAACATAATCTCGAGATTATGTTCTTCAATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-1039s1c1
Sequence:CCGGCGGAGACTATTATGACAATTTCTCGAGAAATTGTCATAATAGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-629s1c1
Sequence:CCGGGCTGGCAACAACCCAGAATTTCTCGAGAAATTCTGGGTTGTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-2186s1c1
Sequence:CCGGCGCTGCGTCATCTGTAATGAACTCGAGTTCATTACAGATGACGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-1523s1c1
Sequence:CCGGCCCAAGTCTTACCTCTCAGTTCTCGAGAACTGAGAGGTAAGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-2250s21c1
Sequence:CCGGTCTACTGTGTCCGAGACTATCCTCGAGGATAGTCTCGGACACAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013860
VALIDATED
LIMD1 MISSION shRNA shRNA Plasmid DNA
LIM domains containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-570s21c1
Sequence:CCGGTCGAGGACCTGAACATGTATGCTCGAGCATACATGTTCAGGTCCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-1661s21c1
Sequence:CCGGAGTAACGTCCATCCGGTAATGCTCGAGCATTACCGGATGGACGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013860.1-3347s21c1
Sequence:CCGGGTCACCTTGTTCAACTCATTTCTCGAGAAATGAGTTGAACAAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013860.1-1031s21c1
Sequence:CCGGCTCACTCACGGAGACTATTATCTCGAGATAATAGTCTCCGTGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-4031s1c1
Sequence:CCGGCCCAGCATTGAAGAACATAATCTCGAGATTATGTTCTTCAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-1039s1c1
Sequence:CCGGCGGAGACTATTATGACAATTTCTCGAGAAATTGTCATAATAGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-629s1c1
Sequence:CCGGGCTGGCAACAACCCAGAATTTCTCGAGAAATTCTGGGTTGTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-2186s1c1
Sequence:CCGGCGCTGCGTCATCTGTAATGAACTCGAGTTCATTACAGATGACGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-1523s1c1
Sequence:CCGGCCCAAGTCTTACCTCTCAGTTCTCGAGAACTGAGAGGTAAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-2250s21c1
Sequence:CCGGTCTACTGTGTCCGAGACTATCCTCGAGGATAGTCTCGGACACAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013860
VALIDATED
LIMD1 MISSION shRNA Lentiviral Transduction Particles
LIM domains containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-570s21c1
Sequence:CCGGTCGAGGACCTGAACATGTATGCTCGAGCATACATGTTCAGGTCCTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-1661s21c1
Sequence:CCGGAGTAACGTCCATCCGGTAATGCTCGAGCATTACCGGATGGACGTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013860.1-3347s21c1
Sequence:CCGGGTCACCTTGTTCAACTCATTTCTCGAGAAATGAGTTGAACAAGGTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013860.1-1031s21c1
Sequence:CCGGCTCACTCACGGAGACTATTATCTCGAGATAATAGTCTCCGTGAGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-4031s1c1
Sequence:CCGGCCCAGCATTGAAGAACATAATCTCGAGATTATGTTCTTCAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-1039s1c1
Sequence:CCGGCGGAGACTATTATGACAATTTCTCGAGAAATTGTCATAATAGTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013860.1-629s1c1
Sequence:CCGGGCTGGCAACAACCCAGAATTTCTCGAGAAATTCTGGGTTGTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-2186s1c1
Sequence:CCGGCGCTGCGTCATCTGTAATGAACTCGAGTTCATTACAGATGACGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013860.1-1523s1c1
Sequence:CCGGCCCAAGTCTTACCTCTCAGTTCTCGAGAACTGAGAGGTAAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013860.1-2250s21c1
Sequence:CCGGTCTACTGTGTCCGAGACTATCCTCGAGGATAGTCTCGGACACAGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)