EMAIL THIS PAGE TO A FRIEND

LIMD2

LIM domain containing 2

138 Gene Product Result for
UniProtKB ID: Q9BT23, D3DU16, Q96S91
Gene ID:
Mouse(67803) LIM domain containing 2
Rat(360646) LIM domain containing 2
chicken(419955) LIM domain containing 2
dog(610728) LIM domain containing 2
cow(508942) LIM domain containing 2
domestic cat(101095294) LIM domain containing 2
domestic guinea pig(100716060) LIM domain containing 2
naked mole-rat(101705644) LIM domain containing 2
sheep(101103078) LIM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013681 MISSION® esiRNA esiRNA targeting human LIMD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030576 Rosetta Predictions human pricing
NM_001025715 Rosetta Predictions rat pricing
NM_172397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233561 predicted 455
2 SASI_Hs01_00233562 predicted 2635
3 SASI_Hs01_00233564 predicted 2689
4 SASI_Hs01_00233565 predicted 2685
5 SASI_Hs01_00233566 predicted 2350
6 SASI_Hs01_00233567 predicted 2351
7 SASI_Hs02_00358146 predicted 2436
8 SASI_Hs01_00233568 predicted 2669
9 SASI_Hs01_00233569 predicted 1938
10 SASI_Hs01_00233570 predicted 1416
11 SASI_Hs01_00233563 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095791 predicted 768
2 SASI_Rn01_00095792 predicted 404
3 SASI_Rn01_00095793 predicted 207
4 SASI_Rn01_00095794 predicted 212
5 SASI_Rn02_00203337 predicted 333
6 SASI_Rn01_00095795 predicted 263
7 SASI_Rn01_00095796 predicted 366
8 SASI_Rn01_00095797 predicted 373
9 SASI_Rn01_00095799 predicted 264
10 SASI_Rn01_00095800 predicted 900
11 SASI_Rn01_00095798 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170073 predicted 409
2 SASI_Mm01_00170074 predicted 453
3 SASI_Mm01_00170075 predicted 690
4 SASI_Mm01_00170076 predicted 622
5 SASI_Mm01_00170077 predicted 218
6 SASI_Mm01_00170078 predicted 339
7 SASI_Mm01_00170079 predicted 429
8 SASI_Mm01_00170080 predicted 730
9 SASI_Mm01_00170081 predicted 211
10 SASI_Mm01_00170082 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030576
VALIDATED
LIMD2 MISSION shRNA Bacterial Glycerol Stock
LIM domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-426s1c1
Sequence:CCGGGCTGTTTAAGAGCAAAGGCAACTCGAGTTGCCTTTGCTCTTAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-381s21c1
Sequence:CCGGAGCACTGTCACACCAAGCTCACTCGAGTGAGCTTGGTGTGACAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-357s21c1
Sequence:CCGGTCCACAACTCTTGCTTCTGCTCTCGAGAGCAGAAGCAAGAGTTGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030576.3-966s21c1
Sequence:CCGGCCTCTACCCTTAACCTGTTTCCTCGAGGAAACAGGTTAAGGGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-427s1c1
Sequence:CCGGCTGTTTAAGAGCAAAGGCAACCTCGAGGTTGCCTTTGCTCTTAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030576.2-2876s1c1
Sequence:CCGGCCACAGTTCCACAATAACCATCTCGAGATGGTTATTGTGGAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-421s1c1
Sequence:CCGGCAGCAGCTGTTTAAGAGCAAACTCGAGTTTGCTCTTAAACAGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-327s1c1
Sequence:CCGGCAACTCTTGCTTCTGCTGCAACTCGAGTTGCAGCAGAAGCAAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-420s1c1
Sequence:CCGGCCAGCAGCTGTTTAAGAGCAACTCGAGTTGCTCTTAAACAGCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030576
VALIDATED
LIMD2 MISSION shRNA shRNA Plasmid DNA
LIM domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-426s1c1
Sequence:CCGGGCTGTTTAAGAGCAAAGGCAACTCGAGTTGCCTTTGCTCTTAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-381s21c1
Sequence:CCGGAGCACTGTCACACCAAGCTCACTCGAGTGAGCTTGGTGTGACAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-357s21c1
Sequence:CCGGTCCACAACTCTTGCTTCTGCTCTCGAGAGCAGAAGCAAGAGTTGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030576.3-966s21c1
Sequence:CCGGCCTCTACCCTTAACCTGTTTCCTCGAGGAAACAGGTTAAGGGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-427s1c1
Sequence:CCGGCTGTTTAAGAGCAAAGGCAACCTCGAGGTTGCCTTTGCTCTTAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030576.2-2876s1c1
Sequence:CCGGCCACAGTTCCACAATAACCATCTCGAGATGGTTATTGTGGAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-421s1c1
Sequence:CCGGCAGCAGCTGTTTAAGAGCAAACTCGAGTTTGCTCTTAAACAGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-327s1c1
Sequence:CCGGCAACTCTTGCTTCTGCTGCAACTCGAGTTGCAGCAGAAGCAAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-420s1c1
Sequence:CCGGCCAGCAGCTGTTTAAGAGCAACTCGAGTTGCTCTTAAACAGCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030576
VALIDATED
LIMD2 MISSION shRNA Lentiviral Transduction Particles
LIM domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-426s1c1
Sequence:CCGGGCTGTTTAAGAGCAAAGGCAACTCGAGTTGCCTTTGCTCTTAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-381s21c1
Sequence:CCGGAGCACTGTCACACCAAGCTCACTCGAGTGAGCTTGGTGTGACAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030576.3-357s21c1
Sequence:CCGGTCCACAACTCTTGCTTCTGCTCTCGAGAGCAGAAGCAAGAGTTGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030576.3-966s21c1
Sequence:CCGGCCTCTACCCTTAACCTGTTTCCTCGAGGAAACAGGTTAAGGGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-427s1c1
Sequence:CCGGCTGTTTAAGAGCAAAGGCAACCTCGAGGTTGCCTTTGCTCTTAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030576.2-2876s1c1
Sequence:CCGGCCACAGTTCCACAATAACCATCTCGAGATGGTTATTGTGGAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030576.2-421s1c1
Sequence:CCGGCAGCAGCTGTTTAAGAGCAAACTCGAGTTTGCTCTTAAACAGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-327s1c1
Sequence:CCGGCAACTCTTGCTTCTGCTGCAACTCGAGTTGCAGCAGAAGCAAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030576.2-420s1c1
Sequence:CCGGCCAGCAGCTGTTTAAGAGCAACTCGAGTTGCTCTTAAACAGCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172397
VALIDATED
LIMD2 MISSION shRNA Bacterial Glycerol Stock
LIM domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-464s1c1
Sequence:CCGGGTTTGGTCGTAAACAGCACAACTCGAGTTGTGCTGTTTACGACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172397.1-2186s1c1
Sequence:CCGGGCCTGTTCTATGTAGTGAGTTCTCGAGAACTCACTACATAGAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2542s21c1
Sequence:CCGGCAGGACCCTTCTGATATAAATCTCGAGATTTATATCAGAAGGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2614s21c1
Sequence:CCGGTCAGTCAAGATATAGTCAATACTCGAGTATTGACTATATCTTGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2042s21c1
Sequence:CCGGACGACAAAGCCTTGGATTTATCTCGAGATAAATCCAAGGCTTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-224s1c1
Sequence:CCGGGCGGTCTAAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTTAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-387s1c1
Sequence:CCGGGCTGCAATGCACGGTGAATTTCTCGAGAAATTCACCGTGCATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-431s1c1
Sequence:CCGGGCTGTTTAAGAGTAAAGGCAACTCGAGTTGCCTTTACTCTTAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1617s21c1
Sequence:CCGGCTAGTCCTTTACCCTAGAAATCTCGAGATTTCTAGGGTAAAGGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1502s21c1
Sequence:CCGGTCGGTTCTTCAGAGGTTAATTCTCGAGAATTAACCTCTGAAGAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172397
VALIDATED
LIMD2 MISSION shRNA shRNA Plasmid DNA
LIM domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-464s1c1
Sequence:CCGGGTTTGGTCGTAAACAGCACAACTCGAGTTGTGCTGTTTACGACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172397.1-2186s1c1
Sequence:CCGGGCCTGTTCTATGTAGTGAGTTCTCGAGAACTCACTACATAGAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2542s21c1
Sequence:CCGGCAGGACCCTTCTGATATAAATCTCGAGATTTATATCAGAAGGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2614s21c1
Sequence:CCGGTCAGTCAAGATATAGTCAATACTCGAGTATTGACTATATCTTGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2042s21c1
Sequence:CCGGACGACAAAGCCTTGGATTTATCTCGAGATAAATCCAAGGCTTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-224s1c1
Sequence:CCGGGCGGTCTAAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTTAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-387s1c1
Sequence:CCGGGCTGCAATGCACGGTGAATTTCTCGAGAAATTCACCGTGCATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-431s1c1
Sequence:CCGGGCTGTTTAAGAGTAAAGGCAACTCGAGTTGCCTTTACTCTTAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1617s21c1
Sequence:CCGGCTAGTCCTTTACCCTAGAAATCTCGAGATTTCTAGGGTAAAGGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1502s21c1
Sequence:CCGGTCGGTTCTTCAGAGGTTAATTCTCGAGAATTAACCTCTGAAGAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172397
VALIDATED
LIMD2 MISSION shRNA Lentiviral Transduction Particles
LIM domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-464s1c1
Sequence:CCGGGTTTGGTCGTAAACAGCACAACTCGAGTTGTGCTGTTTACGACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172397.1-2186s1c1
Sequence:CCGGGCCTGTTCTATGTAGTGAGTTCTCGAGAACTCACTACATAGAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2542s21c1
Sequence:CCGGCAGGACCCTTCTGATATAAATCTCGAGATTTATATCAGAAGGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2614s21c1
Sequence:CCGGTCAGTCAAGATATAGTCAATACTCGAGTATTGACTATATCTTGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-2042s21c1
Sequence:CCGGACGACAAAGCCTTGGATTTATCTCGAGATAAATCCAAGGCTTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-224s1c1
Sequence:CCGGGCGGTCTAAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTTAGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-387s1c1
Sequence:CCGGGCTGCAATGCACGGTGAATTTCTCGAGAAATTCACCGTGCATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172397.1-431s1c1
Sequence:CCGGGCTGTTTAAGAGTAAAGGCAACTCGAGTTGCCTTTACTCTTAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1617s21c1
Sequence:CCGGCTAGTCCTTTACCCTAGAAATCTCGAGATTTCTAGGGTAAAGGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172397.3-1502s21c1
Sequence:CCGGTCGGTTCTTCAGAGGTTAATTCTCGAGAATTAACCTCTGAAGAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)