EMAIL THIS PAGE TO A FRIEND

LIME1

Lck interacting transmembrane adaptor 1

45 Gene Product Result for
Synonyms: LIME LP8067 dJ583P15.4
UniProtKB ID: Q9H400, E1P5K5, E1P5K6, Q5JWJ2, Q6XYB3, Q9NX69
Gene ID:
Human(54923) Summary: LIME1 is a raft-associated transmembrane adaptor phosphoprotein that is preferentially expressed in hemopoietic cells, particularly T cells (Brdickova et al., 2003 [PubMed 14610046]
Mouse(72699) Lck interacting transmembrane adaptor 1
Rat(362289) Lck interacting transmembrane adaptor 1
domestic guinea pig(100715757) Lck interacting transmembrane adaptor 1
naked mole-rat(101724971) Lck interacting transmembrane adaptor 1
cow(100140162) Lck interacting transmembrane adaptor 1
domestic cat(101095732) Lck interacting transmembrane adaptor 1
dog(100687818) Lck interacting transmembrane adaptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017806 Rosetta Predictions human pricing
NM_001108614 Rosetta Predictions rat pricing
NM_023684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141499 predicted 679
2 SASI_Hs01_00141500 predicted 516
3 SASI_Hs01_00141502 predicted 725
4 SASI_Hs01_00141503 predicted 677
5 SASI_Hs01_00141504 predicted 696
6 SASI_Hs01_00141505 predicted 576
7 SASI_Hs01_00141506 predicted 305
8 SASI_Hs01_00141507 predicted 975
9 SASI_Hs02_00350668 predicted 594
10 SASI_Hs02_00350669 predicted 514
11 SASI_Hs01_00141498 predicted 496
12 SASI_Hs01_00141501 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240369 predicted 1189
2 SASI_Rn02_00240370 predicted 1530
3 SASI_Rn02_00240371 predicted 1453
4 SASI_Rn02_00240372 predicted 1210
5 SASI_Rn02_00240373 predicted 1600
6 SASI_Rn02_00240374 predicted 1535
7 SASI_Rn02_00240375 predicted 1446
8 SASI_Rn02_00240376 predicted 1304
9 SASI_Rn02_00240377 predicted 1072
10 SASI_Rn02_00240378 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134610 predicted 1099
2 SASI_Mm02_00327295 predicted 1569
3 SASI_Mm01_00134611 predicted 1368
4 SASI_Mm01_00134612 predicted 1604
5 SASI_Mm01_00134613 predicted 1580
6 SASI_Mm01_00134615 predicted 1594
7 SASI_Mm01_00134616 predicted 1349
8 SASI_Mm01_00134617 predicted 1253
9 SASI_Mm01_00134619 predicted 1494
10 SASI_Mm02_00327296 predicted 1701
11 SASI_Mm01_00134614 predicted 1174
12 SASI_Mm01_00134618 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017806
LIME1 MISSION shRNA Bacterial Glycerol Stock
Lck interacting transmembrane adaptor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-685s21c1
Sequence:CCGGCTCAGGTGGACGTCCTGTACTCTCGAGAGTACAGGACGTCCACCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-318s21c1
Sequence:CCGGAGCAAGTCGGACACCAGACTGCTCGAGCAGTCTGGTGTCCGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-991s21c1
Sequence:CCGGGAACACTCAAGGACCTGTGCTCTCGAGAGCACAGGTCCTTGAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-705s21c1
Sequence:CCGGTCCAGGGTCTGCAAGCCTAAACTCGAGTTTAGGCTTGCAGACCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-863s21c1
Sequence:CCGGGTATGAGAGCATCCGGGAGCTCTCGAGAGCTCCCGGATGCTCTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017806
LIME1 MISSION shRNA shRNA Plasmid DNA
Lck interacting transmembrane adaptor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-685s21c1
Sequence:CCGGCTCAGGTGGACGTCCTGTACTCTCGAGAGTACAGGACGTCCACCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-318s21c1
Sequence:CCGGAGCAAGTCGGACACCAGACTGCTCGAGCAGTCTGGTGTCCGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-991s21c1
Sequence:CCGGGAACACTCAAGGACCTGTGCTCTCGAGAGCACAGGTCCTTGAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-705s21c1
Sequence:CCGGTCCAGGGTCTGCAAGCCTAAACTCGAGTTTAGGCTTGCAGACCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-863s21c1
Sequence:CCGGGTATGAGAGCATCCGGGAGCTCTCGAGAGCTCCCGGATGCTCTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017806
LIME1 MISSION shRNA Lentiviral Transduction Particles
Lck interacting transmembrane adaptor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-685s21c1
Sequence:CCGGCTCAGGTGGACGTCCTGTACTCTCGAGAGTACAGGACGTCCACCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-318s21c1
Sequence:CCGGAGCAAGTCGGACACCAGACTGCTCGAGCAGTCTGGTGTCCGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-991s21c1
Sequence:CCGGGAACACTCAAGGACCTGTGCTCTCGAGAGCACAGGTCCTTGAGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-705s21c1
Sequence:CCGGTCCAGGGTCTGCAAGCCTAAACTCGAGTTTAGGCTTGCAGACCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017806.2-863s21c1
Sequence:CCGGGTATGAGAGCATCCGGGAGCTCTCGAGAGCTCCCGGATGCTCTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023684
LIME1 MISSION shRNA Bacterial Glycerol Stock
Lck interacting transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023684.1-1814s1c1
Sequence:CCGGGTCTTTAACATGAGTTAGGAACTCGAGTTCCTAACTCATGTTAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1593s1c1
Sequence:CCGGACGTCCTATACTCTAGGGTTTCTCGAGAAACCCTAGAGTATAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1597s1c1
Sequence:CCGGCCTATACTCTAGGGTTTGCAACTCGAGTTGCAAACCCTAGAGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1373s1c1
Sequence:CCGGACTAGCTCTGAGGCCACTTATCTCGAGATAAGTGGCCTCAGAGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1543s1c1
Sequence:CCGGCTGCCAAGAATTGCAGCAGAACTCGAGTTCTGCTGCAATTCTTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023684
LIME1 MISSION shRNA shRNA Plasmid DNA
Lck interacting transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023684.1-1814s1c1
Sequence:CCGGGTCTTTAACATGAGTTAGGAACTCGAGTTCCTAACTCATGTTAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1593s1c1
Sequence:CCGGACGTCCTATACTCTAGGGTTTCTCGAGAAACCCTAGAGTATAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1597s1c1
Sequence:CCGGCCTATACTCTAGGGTTTGCAACTCGAGTTGCAAACCCTAGAGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1373s1c1
Sequence:CCGGACTAGCTCTGAGGCCACTTATCTCGAGATAAGTGGCCTCAGAGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1543s1c1
Sequence:CCGGCTGCCAAGAATTGCAGCAGAACTCGAGTTCTGCTGCAATTCTTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023684
LIME1 MISSION shRNA Lentiviral Transduction Particles
Lck interacting transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023684.1-1814s1c1
Sequence:CCGGGTCTTTAACATGAGTTAGGAACTCGAGTTCCTAACTCATGTTAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1593s1c1
Sequence:CCGGACGTCCTATACTCTAGGGTTTCTCGAGAAACCCTAGAGTATAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1597s1c1
Sequence:CCGGCCTATACTCTAGGGTTTGCAACTCGAGTTGCAAACCCTAGAGTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1373s1c1
Sequence:CCGGACTAGCTCTGAGGCCACTTATCTCGAGATAAGTGGCCTCAGAGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023684.1-1543s1c1
Sequence:CCGGCTGCCAAGAATTGCAGCAGAACTCGAGTTCTGCTGCAATTCTTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)