EMAIL THIS PAGE TO A FRIEND

LIMK1

LIM domain kinase 1

146 Gene Product Result for
Synonyms: LIMK LIMK-1
Gene ID:
Human(3984) Summary: There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. LIMK1 is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein is ubiquitously expressed during development and plays a role in many cellular processes associated with cytoskeletal structure. This protein also stimulates axon growth and may play a role in brain development. LIMK1 hemizygosity is implicated in the impaired visuospatial constructive cognition of Williams syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Feb 2011]
Mouse(16885) LIM-domain containing, protein kinase
Rat(65172) LIM domain kinase 1
fruit fly(32207) LIM-kinase1
cow(535225) LIM domain kinase 1
Horse(100062100) LIM domain kinase 1
domestic cat(101097861) LIM domain kinase 1
chicken(373922) LIM domain kinase 1
dog(489800) LIM domain kinase 1
domestic guinea pig(100712921) LIM domain kinase 1
naked mole-rat(101698555) LIM domain kinase 1
sheep(101110900) LIM domain kinase 1
Domestic Rabbit(100344018) LIM domain kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305660 ANTI-LIM KINASE 1 (LIMK1)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
L2290 Anti-LIM Kinase 1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
microarray, western blot pricing
SAB1412525 ANTI-LIMK1 antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412526 ANTI-LIMK1 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412556 ANTI-LIMK1 antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA028064 Anti-LIMK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA028516 Anti-LIMK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry pricing
SAB4501755 Anti-LIMK1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501756 Anti-LIMK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4501757 Anti-LIMK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300103 Anti-phospho-LIMK1 (pThr508) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504460 Anti-phospho-LIMK1 (pThr508) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0003984M1 Monoclonal Anti-LIMK1 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404026 Monoclonal Anti-LIMK1, (C-terminal) antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002314 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073301 MISSION® esiRNA esiRNA human LIMK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002314 Rosetta Predictions human pricing
NM_031727 Rosetta Predictions rat pricing
NM_010717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154610 predicted 1120
2 SASI_Hs01_00154611 predicted 1681
3 SASI_Hs01_00154612 predicted 975
4 SASI_Hs01_00154613 predicted 1229
5 SASI_Hs01_00154614 predicted 1750
6 SASI_Hs01_00154615 predicted 1384
7 SASI_Hs01_00154616 predicted 1846
8 SASI_Hs01_00154618 predicted 1510
9 SASI_Hs01_00154619 predicted 1292
10 SASI_Hs02_00333632 predicted 669
11 SASI_Hs01_00154617 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059079 predicted 1854
2 SASI_Rn01_00059080 predicted 1796
3 SASI_Rn02_00265105 predicted 335
4 SASI_Rn01_00059081 predicted 1841
5 SASI_Rn01_00059082 predicted 1406
6 SASI_Rn01_00059084 predicted 1787
7 SASI_Rn01_00059085 predicted 273
8 SASI_Rn01_00059086 predicted 1742
9 SASI_Rn01_00059087 predicted 590
10 SASI_Rn02_00265106 predicted 1657
11 SASI_Rn01_00059083 predicted 550
12 SASI_Rn01_00059088 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175673 predicted 1668
2 SASI_Mm01_00175674 predicted 1751
3 SASI_Mm02_00319189 predicted 1327
4 SASI_Mm01_00175675 predicted 1810
5 SASI_Mm01_00175676 predicted 1795
6 SASI_Mm01_00175677 predicted 1298
7 SASI_Mm01_00175680 predicted 1415
8 SASI_Mm01_00175681 predicted 533
9 SASI_Mm01_00175682 predicted 1694
10 SASI_Mm02_00319190 predicted 494
11 SASI_Mm01_00175678 predicted 416
12 SASI_Mm01_00175679 predicted 1785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010717
VALIDATED
LIMK1 MISSION shRNA Bacterial Glycerol Stock
LIM domain kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1287s21c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-535s21c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1546s1c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1797s1c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1414s1c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1672s1c1
Sequence:CCGGCCTCCATTCGATGAACATCATCTCGAGATGATGTTCATCGAATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-662s1c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1419s21c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1670s21c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010717
VALIDATED
LIMK1 MISSION shRNA shRNA Plasmid DNA
LIM domain kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1287s21c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-535s21c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1546s1c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1797s1c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1414s1c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1672s1c1
Sequence:CCGGCCTCCATTCGATGAACATCATCTCGAGATGATGTTCATCGAATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-662s1c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1419s21c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1670s21c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010717
VALIDATED
LIMK1 MISSION shRNA Lentiviral Transduction Particles
LIM domain kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1287s21c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-535s21c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1546s1c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1797s1c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1414s1c1
Sequence:CCGGGATGGTGATGAAGGAACTTATCTCGAGATAAGTTCCTTCATCACCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-1672s1c1
Sequence:CCGGCCTCCATTCGATGAACATCATCTCGAGATGATGTTCATCGAATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010717.1-662s1c1
Sequence:CCGGTGTGGAAACTTCATTGGCGATCTCGAGATCGCCAATGAAGTTTCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1419s21c1
Sequence:CCGGGCTAAACTTCATCACAGAGTACTCGAGTACTCTGTGATGAAGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010717.2-1670s21c1
Sequence:CCGGCTGAAGACTTACGCAGCCTTACTCGAGTAAGGCTGCGTAAGTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002314
VALIDATED
LIMK1 MISSION shRNA Bacterial Glycerol Stock
LIM domain kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-822s1c1
Sequence:CCGGCGGAGACCGGATCTTGGAAATCTCGAGATTTCCAAGATCCGGTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-199s1c1
Sequence:CCGGGAAGAACGTATGGGAGAGGAACTCGAGTTCCTCTCCCATACGTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-1374s1c1
Sequence:CCGGCTACAAGGACAAGAGGCTCAACTCGAGTTGAGCCTCTTGTCCTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-874s1c1
Sequence:CCGGGACGAGATTGACCTGCTGATTCTCGAGAATCAGCAGGTCAATCTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-3140s1c1
Sequence:CCGGCAGTTGAGCATCTAGGAAGTACTCGAGTACTTCCTAGATGCTCAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.x-1512s1c1
Sequence:CCGGCTACCTCCACTCCATGAACATCTCGAGATGTTCATGGAGTGGAGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-1773s1c1
Sequence:CCGGGATCGTCCTGTGCGAGATCATCTCGAGATGATCTCGCACAGGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-980s1c1
Sequence:CCGGCCCTGAGCTCTCCGGCTTATACTCGAGTATAAGCCGGAGAGCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-2636s1c1
Sequence:CCGGGCAACAGGTATCGAGGACTCTCTCGAGAGAGTCCTCGATACCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-570s1c1
Sequence:CCGGGCACTGCTACTACCAGACTGTCTCGAGACAGTCTGGTAGTAGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-417s1c1
Sequence:CCGGCCATGGGTGCTCTGAGCAAATCTCGAGATTTGCTCAGAGCACCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-1733s1c1
Sequence:CCGGGCCGCAGCTATGATGAGAAGGCTCGAGCCTTCTCATCATAGCTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002314
VALIDATED
LIMK1 MISSION shRNA shRNA Plasmid DNA
LIM domain kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-822s1c1
Sequence:CCGGCGGAGACCGGATCTTGGAAATCTCGAGATTTCCAAGATCCGGTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-199s1c1
Sequence:CCGGGAAGAACGTATGGGAGAGGAACTCGAGTTCCTCTCCCATACGTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-1374s1c1
Sequence:CCGGCTACAAGGACAAGAGGCTCAACTCGAGTTGAGCCTCTTGTCCTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-874s1c1
Sequence:CCGGGACGAGATTGACCTGCTGATTCTCGAGAATCAGCAGGTCAATCTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-3140s1c1
Sequence:CCGGCAGTTGAGCATCTAGGAAGTACTCGAGTACTTCCTAGATGCTCAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.x-1512s1c1
Sequence:CCGGCTACCTCCACTCCATGAACATCTCGAGATGTTCATGGAGTGGAGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-1773s1c1
Sequence:CCGGGATCGTCCTGTGCGAGATCATCTCGAGATGATCTCGCACAGGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-980s1c1
Sequence:CCGGCCCTGAGCTCTCCGGCTTATACTCGAGTATAAGCCGGAGAGCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-2636s1c1
Sequence:CCGGGCAACAGGTATCGAGGACTCTCTCGAGAGAGTCCTCGATACCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-570s1c1
Sequence:CCGGGCACTGCTACTACCAGACTGTCTCGAGACAGTCTGGTAGTAGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-417s1c1
Sequence:CCGGCCATGGGTGCTCTGAGCAAATCTCGAGATTTGCTCAGAGCACCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-1733s1c1
Sequence:CCGGGCCGCAGCTATGATGAGAAGGCTCGAGCCTTCTCATCATAGCTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002314
VALIDATED
LIMK1 MISSION shRNA Lentiviral Transduction Particles
LIM domain kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-822s1c1
Sequence:CCGGCGGAGACCGGATCTTGGAAATCTCGAGATTTCCAAGATCCGGTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-199s1c1
Sequence:CCGGGAAGAACGTATGGGAGAGGAACTCGAGTTCCTCTCCCATACGTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-1374s1c1
Sequence:CCGGCTACAAGGACAAGAGGCTCAACTCGAGTTGAGCCTCTTGTCCTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-874s1c1
Sequence:CCGGGACGAGATTGACCTGCTGATTCTCGAGAATCAGCAGGTCAATCTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.x-3140s1c1
Sequence:CCGGCAGTTGAGCATCTAGGAAGTACTCGAGTACTTCCTAGATGCTCAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.x-1512s1c1
Sequence:CCGGCTACCTCCACTCCATGAACATCTCGAGATGTTCATGGAGTGGAGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-1773s1c1
Sequence:CCGGGATCGTCCTGTGCGAGATCATCTCGAGATGATCTCGCACAGGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-980s1c1
Sequence:CCGGCCCTGAGCTCTCCGGCTTATACTCGAGTATAAGCCGGAGAGCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-2636s1c1
Sequence:CCGGGCAACAGGTATCGAGGACTCTCTCGAGAGAGTCCTCGATACCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-570s1c1
Sequence:CCGGGCACTGCTACTACCAGACTGTCTCGAGACAGTCTGGTAGTAGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002314.2-417s1c1
Sequence:CCGGCCATGGGTGCTCTGAGCAAATCTCGAGATTTGCTCAGAGCACCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002314.2-1733s1c1
Sequence:CCGGGCCGCAGCTATGATGAGAAGGCTCGAGCCTTCTCATCATAGCTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)