EMAIL THIS PAGE TO A FRIEND

LIMS1

LIM and senescent cell antigen-like domains 1

65 Gene Product Result for
Synonyms: PINCH PINCH-1 PINCH1
Gene ID:
Human(3987) Summary: The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(110829) LIM and senescent cell antigen-like domains 1
Rat(499443) LIM and senescent cell antigen-like domains 1
domestic guinea pig(100735007) LIM and senescent cell antigen-like domains 1
naked mole-rat(101696476) LIM and senescent cell antigen-like domains 1
sheep(101116555) LIM and senescent cell antigen-like domains 1
Zebrafish(554019) LIM and senescent cell antigen-like domains 1
chicken(414880) LIM and senescent cell antigen-like domains 1
dog(474540) LIM and senescent cell antigen-like domains 1
Horse(100060267) LIM and senescent cell antigen-like domains 1
cow(540281) LIM and senescent cell antigen-like domains 1
domestic cat(101094258) LIM and senescent cell antigen-like domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045699 Anti-ARHGEF35 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1104861 Anti-LIMS1 (241-251) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2701074 Anti-LIMS1 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse
western blot pricing
SAB2701201 Anti-LIMS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA058455 Anti-LIMS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA061230 Anti-LIMS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB5300437 Monoclonal Anti-LIMS1 antibody produced in mouse clone 5G7, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing
P8996 Monoclonal Anti-PINCH-1 antibody produced in mouse clone PINCH-C58, purified immunoglobulin, buffered aqueous solution bovine, monkey, rat, canine, human, mouse, hamster
ELISA, immunoprecipitation (IP), western blot pricing
P9371 Monoclonal Anti-PINCH-1 antibody produced in mouse clone PINCH-N173, purified immunoglobulin, buffered aqueous solution canine, monkey, mouse, rat, human, bovine
ELISA, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004987 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004987 Rosetta Predictions human pricing
XM_001053331 Rosetta Predictions rat pricing
XM_574766 Rosetta Predictions rat pricing
NM_026148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338709 predicted 948
2 SASI_Hs01_00229488 predicted 1015
3 SASI_Hs01_00229489 predicted 876
4 SASI_Hs01_00229490 predicted 1086
5 SASI_Hs01_00229491 predicted 290
6 SASI_Hs02_00338710 predicted 944
7 SASI_Hs01_00229492 predicted 358
8 SASI_Hs01_00229493 predicted 355
9 SASI_Hs01_00229494 predicted 286
10 SASI_Hs01_00229496 predicted 827
11 SASI_Hs01_00229487 predicted 1086
12 SASI_Hs01_00229495 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271987 predicted 975
2 SASI_Rn02_00271988 predicted 235
3 SASI_Rn02_00271989 predicted 456
4 SASI_Rn02_00271990 predicted 996
5 SASI_Rn02_00271991 predicted 586
6 SASI_Rn02_00271992 predicted 955
7 SASI_Rn02_00271993 predicted 805
8 SASI_Rn02_00271994 predicted 948
9 SASI_Rn02_00271995 predicted 475
10 SASI_Rn02_00271996 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402540 predicted 238
2 SASI_Rn02_00402541 predicted 811
3 SASI_Rn02_00402542 predicted 702
4 SASI_Rn02_00402543 predicted 206
5 SASI_Rn02_00402544 predicted 781
6 SASI_Rn02_00402545 predicted 777
7 SASI_Rn02_00402546 predicted 713
8 SASI_Rn02_00402547 predicted 825
9 SASI_Rn02_00402548 predicted 200
10 SASI_Rn02_00402549 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329761 predicted 456
2 SASI_Mm01_00170226 predicted 852
3 SASI_Mm01_00170227 predicted 1087
4 SASI_Mm01_00170228 predicted 543
5 SASI_Mm01_00170229 predicted 484
6 SASI_Mm01_00170230 predicted 355
7 SASI_Mm01_00170231 predicted 1039
8 SASI_Mm01_00170232 predicted 204
9 SASI_Mm01_00170233 predicted 596
10 SASI_Mm01_00170234 predicted 733
11 SASI_Mm01_00170235 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004987
VALIDATED
LIMS1 MISSION shRNA Bacterial Glycerol Stock
LIM and senescent cell antigen-like domains 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-477s1c1
Sequence:CCGGCCCTGTCATAATCGTGAGAAACTCGAGTTTCTCACGATTATGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1302s1c1
Sequence:CCGGCCCTTATCCATTTGTTGACATCTCGAGATGTCAACAAATGGATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1074s1c1
Sequence:CCGGGCTGAGACCTTAGGAAGGAAACTCGAGTTTCCTTCCTAAGGTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1011s1c1
Sequence:CCGGCCAGTCTGTAAGAAGTGCTATCTCGAGATAGCACTTCTTACAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004987.3-360s1c1
Sequence:CCGGCGAGTTATCAAAGCCATGAATCTCGAGATTCATGGCTTTGATAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1026s21c1
Sequence:CCGGTGCTATGAGAAATTTCCATTGCTCGAGCAATGGAAATTTCTCATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-965s21c1
Sequence:CCGGCACTAAATTAACACTCAAGAACTCGAGTTCTTGAGTGTTAATTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004987.3-982s21c1
Sequence:CCGGAGAATAAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1066s21c1
Sequence:CCGGAGAAACTAGCTGAGACCTTAGCTCGAGCTAAGGTCTCAGCTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1018s21c1
Sequence:CCGGGTAAGAAGTGCTATGAGAAATCTCGAGATTTCTCATAGCACTTCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-973s21c1
Sequence:CCGGTAACACTCAAGAATAAGTTTGCTCGAGCAAACTTATTCTTGAGTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1000s21c1
Sequence:CCGGTTGACATGAAGCCAGTCTGTACTCGAGTACAGACTGGCTTCATGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004987
VALIDATED
LIMS1 MISSION shRNA shRNA Plasmid DNA
LIM and senescent cell antigen-like domains 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-477s1c1
Sequence:CCGGCCCTGTCATAATCGTGAGAAACTCGAGTTTCTCACGATTATGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1302s1c1
Sequence:CCGGCCCTTATCCATTTGTTGACATCTCGAGATGTCAACAAATGGATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1074s1c1
Sequence:CCGGGCTGAGACCTTAGGAAGGAAACTCGAGTTTCCTTCCTAAGGTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1011s1c1
Sequence:CCGGCCAGTCTGTAAGAAGTGCTATCTCGAGATAGCACTTCTTACAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004987.3-360s1c1
Sequence:CCGGCGAGTTATCAAAGCCATGAATCTCGAGATTCATGGCTTTGATAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1026s21c1
Sequence:CCGGTGCTATGAGAAATTTCCATTGCTCGAGCAATGGAAATTTCTCATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-965s21c1
Sequence:CCGGCACTAAATTAACACTCAAGAACTCGAGTTCTTGAGTGTTAATTTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004987.3-982s21c1
Sequence:CCGGAGAATAAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1066s21c1
Sequence:CCGGAGAAACTAGCTGAGACCTTAGCTCGAGCTAAGGTCTCAGCTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1018s21c1
Sequence:CCGGGTAAGAAGTGCTATGAGAAATCTCGAGATTTCTCATAGCACTTCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-973s21c1
Sequence:CCGGTAACACTCAAGAATAAGTTTGCTCGAGCAAACTTATTCTTGAGTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1000s21c1
Sequence:CCGGTTGACATGAAGCCAGTCTGTACTCGAGTACAGACTGGCTTCATGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004987
VALIDATED
LIMS1 MISSION shRNA Lentiviral Transduction Particles
LIM and senescent cell antigen-like domains 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-477s1c1
Sequence:CCGGCCCTGTCATAATCGTGAGAAACTCGAGTTTCTCACGATTATGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1302s1c1
Sequence:CCGGCCCTTATCCATTTGTTGACATCTCGAGATGTCAACAAATGGATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1074s1c1
Sequence:CCGGGCTGAGACCTTAGGAAGGAAACTCGAGTTTCCTTCCTAAGGTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004987.3-1011s1c1
Sequence:CCGGCCAGTCTGTAAGAAGTGCTATCTCGAGATAGCACTTCTTACAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004987.3-360s1c1
Sequence:CCGGCGAGTTATCAAAGCCATGAATCTCGAGATTCATGGCTTTGATAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1026s21c1
Sequence:CCGGTGCTATGAGAAATTTCCATTGCTCGAGCAATGGAAATTTCTCATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-965s21c1
Sequence:CCGGCACTAAATTAACACTCAAGAACTCGAGTTCTTGAGTGTTAATTTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004987.3-982s21c1
Sequence:CCGGAGAATAAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1066s21c1
Sequence:CCGGAGAAACTAGCTGAGACCTTAGCTCGAGCTAAGGTCTCAGCTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1018s21c1
Sequence:CCGGGTAAGAAGTGCTATGAGAAATCTCGAGATTTCTCATAGCACTTCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-973s21c1
Sequence:CCGGTAACACTCAAGAATAAGTTTGCTCGAGCAAACTTATTCTTGAGTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004987.3-1000s21c1
Sequence:CCGGTTGACATGAAGCCAGTCTGTACTCGAGTACAGACTGGCTTCATGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026148
VALIDATED
LIMS1 MISSION shRNA Bacterial Glycerol Stock
LIM and senescent cell antigen-like domains 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-1118s1c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-911s1c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-440s1c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-583s1c1
Sequence:CCGGGCCCATGTCATGATCGTGAAACTCGAGTTTCACGATCATGACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-288s1c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-358s21c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-829s21c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-1036s21c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-206s21c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026148
VALIDATED
LIMS1 MISSION shRNA shRNA Plasmid DNA
LIM and senescent cell antigen-like domains 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-1118s1c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-911s1c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-440s1c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-583s1c1
Sequence:CCGGGCCCATGTCATGATCGTGAAACTCGAGTTTCACGATCATGACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-288s1c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-358s21c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-829s21c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-1036s21c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-206s21c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026148
VALIDATED
LIMS1 MISSION shRNA Lentiviral Transduction Particles
LIM and senescent cell antigen-like domains 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-1118s1c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-911s1c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-440s1c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026148.1-583s1c1
Sequence:CCGGGCCCATGTCATGATCGTGAAACTCGAGTTTCACGATCATGACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026148.1-288s1c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-358s21c1
Sequence:CCGGCCACCAATGTGGTGAATTCATCTCGAGATGAATTCACCACATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-829s21c1
Sequence:CCGGGCATCGCCATTATGAGAGGAACTCGAGTTCCTCTCATAATGGCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-1036s21c1
Sequence:CCGGGCCAGTCTGTAAGAAGTGCTACTCGAGTAGCACTTCTTACAGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026148.2-206s21c1
Sequence:CCGGGAGAAGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)