EMAIL THIS PAGE TO A FRIEND

LIMS3

LIM and senescent cell antigen-like domains 3

14 Gene Product Result for
Synonyms: PINCH-3
Species: Human LIMS3(96626)
UniProtKB ID: P0CW19, Q9HB10
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305671 ANTI-LIMS3/LIMS3L (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033514 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202237 predicted 373
2 SASI_Hs01_00202239 predicted 501
3 SASI_Hs01_00202241 predicted 499
4 SASI_Hs01_00202242 predicted 392
5 SASI_Hs01_00202243 predicted 385
6 SASI_Hs01_00202244 predicted 525
7 SASI_Hs01_00202245 predicted 378
8 SASI_Hs01_00202246 predicted 456
9 SASI_Hs02_00361399 predicted 501
10 SASI_Hs02_00361400 predicted 379
11 SASI_Hs01_00202238 predicted 558
12 SASI_Hs01_00202240 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033514
LIMS3 MISSION shRNA Bacterial Glycerol Stock
LIM and senescent cell antigen-like domains 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-178s1c1
Sequence:CCGGCGTGAAAGTCTACAAGGAGTTCTCGAGAACTCCTTGTAGACTTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-366s1c1
Sequence:CCGGGACTCTTCTATGAGGAACGAACTCGAGTTCGTTCCTCATAGAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033514.1-737s1c1
Sequence:CCGGGCATCTGGAGAATAAGACATTCTCGAGAATGTCTTATTCTCCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-187s1c1
Sequence:CCGGCTACAAGGAGTTCTGTGACTTCTCGAGAAGTCACAGAACTCCTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-172s1c1
Sequence:CCGGCAGTGACGTGAAAGTCTACAACTCGAGTTGTAGACTTTCACGTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-284s1c1
Sequence:CCGGGAGACGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-362s1c1
Sequence:CCGGGAAGGACTCTTCTATGAGGAACTCGAGTTCCTCATAGAAGAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-781s21c1
Sequence:CCGGCCCTCACACTGGACTATAAATCTCGAGATTTATAGTCCAGTGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-898s21c1
Sequence:CCGGGTCCTGAGGAAGATTACTATTCTCGAGAATAGTAATCTTCCTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-618s21c1
Sequence:CCGGATGGTTAAGCTACCTTCATTACTCGAGTAATGAAGGTAGCTTAACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-606s21c1
Sequence:CCGGGGAACGAACGTGATGGTTAAGCTCGAGCTTAACCATCACGTTCGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033514
LIMS3 MISSION shRNA shRNA Plasmid DNA
LIM and senescent cell antigen-like domains 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-178s1c1
Sequence:CCGGCGTGAAAGTCTACAAGGAGTTCTCGAGAACTCCTTGTAGACTTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-366s1c1
Sequence:CCGGGACTCTTCTATGAGGAACGAACTCGAGTTCGTTCCTCATAGAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033514.1-737s1c1
Sequence:CCGGGCATCTGGAGAATAAGACATTCTCGAGAATGTCTTATTCTCCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-187s1c1
Sequence:CCGGCTACAAGGAGTTCTGTGACTTCTCGAGAAGTCACAGAACTCCTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-172s1c1
Sequence:CCGGCAGTGACGTGAAAGTCTACAACTCGAGTTGTAGACTTTCACGTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-284s1c1
Sequence:CCGGGAGACGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-362s1c1
Sequence:CCGGGAAGGACTCTTCTATGAGGAACTCGAGTTCCTCATAGAAGAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-781s21c1
Sequence:CCGGCCCTCACACTGGACTATAAATCTCGAGATTTATAGTCCAGTGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-898s21c1
Sequence:CCGGGTCCTGAGGAAGATTACTATTCTCGAGAATAGTAATCTTCCTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-618s21c1
Sequence:CCGGATGGTTAAGCTACCTTCATTACTCGAGTAATGAAGGTAGCTTAACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-606s21c1
Sequence:CCGGGGAACGAACGTGATGGTTAAGCTCGAGCTTAACCATCACGTTCGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033514
LIMS3 MISSION shRNA Lentiviral Transduction Particles
LIM and senescent cell antigen-like domains 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-178s1c1
Sequence:CCGGCGTGAAAGTCTACAAGGAGTTCTCGAGAACTCCTTGTAGACTTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-366s1c1
Sequence:CCGGGACTCTTCTATGAGGAACGAACTCGAGTTCGTTCCTCATAGAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033514.1-737s1c1
Sequence:CCGGGCATCTGGAGAATAAGACATTCTCGAGAATGTCTTATTCTCCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-187s1c1
Sequence:CCGGCTACAAGGAGTTCTGTGACTTCTCGAGAAGTCACAGAACTCCTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033514.1-172s1c1
Sequence:CCGGCAGTGACGTGAAAGTCTACAACTCGAGTTGTAGACTTTCACGTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-284s1c1
Sequence:CCGGGAGACGATCGTGAACAGTAATCTCGAGATTACTGTTCACGATCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033514.1-362s1c1
Sequence:CCGGGAAGGACTCTTCTATGAGGAACTCGAGTTCCTCATAGAAGAGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-781s21c1
Sequence:CCGGCCCTCACACTGGACTATAAATCTCGAGATTTATAGTCCAGTGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033514.3-898s21c1
Sequence:CCGGGTCCTGAGGAAGATTACTATTCTCGAGAATAGTAATCTTCCTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-618s21c1
Sequence:CCGGATGGTTAAGCTACCTTCATTACTCGAGTAATGAAGGTAGCTTAACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033514.3-606s21c1
Sequence:CCGGGGAACGAACGTGATGGTTAAGCTCGAGCTTAACCATCACGTTCGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)