EMAIL THIS PAGE TO A FRIEND

LIN28A

lin-28 homolog A (C. elegans)

216 Gene Product Result for
Synonyms: CSDD1 LIN-28 LIN28 ZCCHC1 lin-28A
UniProtKB ID: Q9H9Z2
Gene ID:
Mouse(83557) lin-28 homolog A (C. elegans)
Rat(500562) lin-28 homolog A (C. elegans)
Zebrafish(394066) lin-28 homolog A (C. elegans)
cow(614997) lin-28 homolog A (C. elegans)
Horse(100071098) lin-28 homolog A (C. elegans)
domestic cat(100379627) lin-28 homolog A (C. elegans)
dog(612162) lin-28 homolog A (C. elegans)
chicken(428206) lin-28 homolog A (C. elegans)
domestic guinea pig(100715141) lin-28 homolog A (C. elegans)
naked mole-rat(101711416) lin-28 homolog A (C. elegans)
sheep(100302344) lin-28 homolog A (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1102369 Anti-LIN28 (183-195) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4200554 Anti-LIN28 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human
immunoprecipitation (IP), western blot pricing
SAB1407963 Anti-LIN28 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300679 Anti-Lin28 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB2101346 Anti-LIN28 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, goat, pig, bovine, human, rat, canine, sheep, yeast, mouse
immunohistochemistry, western blot pricing
SAB4200553 Anti-LIN28 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
immunoprecipitation (IP), western blot pricing
SAB1300689 Anti-LIN28A (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300688 Anti-LIN28A (N-term) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB2702125 Anti-LIN28A antibody produced in rabbit pig, mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB4200413 Monoclonal Anti-LIN28 antibody produced in mouse clone L28.5, tissue culture supernatant human, mouse
western blot pricing
SAB5300058 Monoclonal Anti-LIN28 antibody produced in mouse clone 6D1F9, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB1300136 Monoclonal Anti-LIN28A antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024674 Rosetta Predictions human pricing
NM_001109269 Rosetta Predictions rat pricing
NM_145833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152493 predicted 921
2 SASI_Hs01_00152494 predicted 450
3 SASI_Hs01_00152496 predicted 533
4 SASI_Hs01_00152497 predicted 417
5 SASI_Hs01_00152498 predicted 526
6 SASI_Hs02_00357095 predicted 326
7 SASI_Hs01_00152499 predicted 496
8 SASI_Hs01_00152500 predicted 823
9 SASI_Hs01_00152501 predicted 907
10 SASI_Hs02_00357096 predicted 589
11 SASI_Hs01_00152495 predicted 315
12 SASI_Hs01_00152502 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246754 predicted 905
2 SASI_Rn02_00246755 predicted 1063
3 SASI_Rn02_00246756 predicted 1066
4 SASI_Rn02_00246757 predicted 1078
5 SASI_Rn02_00246758 predicted 350
6 SASI_Rn02_00246759 predicted 1071
7 SASI_Rn02_00246760 predicted 942
8 SASI_Rn02_00246761 predicted 1034
9 SASI_Rn02_00246762 predicted 1092
10 SASI_Rn02_00246763 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341300 predicted 879
2 SASI_Mm01_00113336 predicted 1121
3 SASI_Mm01_00113338 predicted 711
4 SASI_Mm01_00113339 predicted 408
5 SASI_Mm01_00113340 predicted 891
6 SASI_Mm01_00113341 predicted 633
7 SASI_Mm01_00113342 predicted 1029
8 SASI_Mm01_00113343 predicted 885
9 SASI_Mm01_00113344 predicted 378
10 SASI_Mm02_00341301 predicted 936
11 SASI_Mm01_00113335 predicted 888
12 SASI_Mm01_00113337 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024674
LIN28A MISSION shRNA Bacterial Glycerol Stock
lin-28 homolog A (C. elegans)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-494s21c1
Sequence:CCGGAGAGCATGCAGAAGCGCAGATCTCGAGATCTGCGCTTCTGCATGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-733s21c1
Sequence:CCGGGCACAGAATTGAGCCACAATGCTCGAGCATTGTGGCTCAATTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024674.4-834s21c1
Sequence:CCGGTAGTTGGCACTGCCATGTATCCTCGAGGATACATGGCAGTGCCAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-448s1c1
Sequence:CCGGCCTGGTGGAGTATTCTGTATTCTCGAGAATACAGAATACTCCACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-679s1c1
Sequence:CCGGACCTACTTTCGAGAGGAAGAACTCGAGTTCTTCCTCTCGAAAGTAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-336s1c1
Sequence:CCGGGCACCAGAGTAAGCTGCACATCTCGAGATGTGCAGCTTACTCTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-529s1c1
Sequence:CCGGTGCTACAACTGTGGAGGTCTACTCGAGTAGACCTCCACAGTTGTAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024674
LIN28A MISSION shRNA shRNA Plasmid DNA
lin-28 homolog A (C. elegans)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-494s21c1
Sequence:CCGGAGAGCATGCAGAAGCGCAGATCTCGAGATCTGCGCTTCTGCATGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-733s21c1
Sequence:CCGGGCACAGAATTGAGCCACAATGCTCGAGCATTGTGGCTCAATTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024674.4-834s21c1
Sequence:CCGGTAGTTGGCACTGCCATGTATCCTCGAGGATACATGGCAGTGCCAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-448s1c1
Sequence:CCGGCCTGGTGGAGTATTCTGTATTCTCGAGAATACAGAATACTCCACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-679s1c1
Sequence:CCGGACCTACTTTCGAGAGGAAGAACTCGAGTTCTTCCTCTCGAAAGTAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-336s1c1
Sequence:CCGGGCACCAGAGTAAGCTGCACATCTCGAGATGTGCAGCTTACTCTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-529s1c1
Sequence:CCGGTGCTACAACTGTGGAGGTCTACTCGAGTAGACCTCCACAGTTGTAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024674
LIN28A MISSION shRNA Lentiviral Transduction Particles
lin-28 homolog A (C. elegans)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-494s21c1
Sequence:CCGGAGAGCATGCAGAAGCGCAGATCTCGAGATCTGCGCTTCTGCATGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024674.4-733s21c1
Sequence:CCGGGCACAGAATTGAGCCACAATGCTCGAGCATTGTGGCTCAATTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024674.4-834s21c1
Sequence:CCGGTAGTTGGCACTGCCATGTATCCTCGAGGATACATGGCAGTGCCAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-448s1c1
Sequence:CCGGCCTGGTGGAGTATTCTGTATTCTCGAGAATACAGAATACTCCACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-679s1c1
Sequence:CCGGACCTACTTTCGAGAGGAAGAACTCGAGTTCTTCCTCTCGAAAGTAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-336s1c1
Sequence:CCGGGCACCAGAGTAAGCTGCACATCTCGAGATGTGCAGCTTACTCTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024674.3-529s1c1
Sequence:CCGGTGCTACAACTGTGGAGGTCTACTCGAGTAGACCTCCACAGTTGTAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145833
LIN28A MISSION shRNA Bacterial Glycerol Stock
lin-28 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145833.1-685s21c1
Sequence:CCGGCTCCCAGAAGCCCAGAATTGACTCGAGTCAATTCTGGGCTTCTGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-1029s21c1
Sequence:CCGGGAAGCGAAACAAGTGTCAAACCTCGAGGTTTGACACTTGTTTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-995s21c1
Sequence:CCGGTAGAAGGCTGTGTGATATTTCCTCGAGGAAATATCACACAGCCTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145833.1-2017s1c1
Sequence:CCGGCCCAGTAAGAATGCAACTTAACTCGAGTTAAGTTGCATTCTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-201s1c1
Sequence:CCGGCATCTGTAAGTGGTTCAACGTCTCGAGACGTTGAACCACTTACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-477s1c1
Sequence:CCGGCAAAGGAGACAGGTGCTACAACTCGAGTTGTAGCACCTGTCTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-360s1c1
Sequence:CCGGCACCTTTAAGAAGTCTGCCAACTCGAGTTGGCAGACTTCTTAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-543s1c1
Sequence:CCGGCCAGCCCAAGAAGTGCCACTTCTCGAGAAGTGGCACTTCTTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145833
LIN28A MISSION shRNA shRNA Plasmid DNA
lin-28 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145833.1-685s21c1
Sequence:CCGGCTCCCAGAAGCCCAGAATTGACTCGAGTCAATTCTGGGCTTCTGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-1029s21c1
Sequence:CCGGGAAGCGAAACAAGTGTCAAACCTCGAGGTTTGACACTTGTTTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-995s21c1
Sequence:CCGGTAGAAGGCTGTGTGATATTTCCTCGAGGAAATATCACACAGCCTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145833.1-2017s1c1
Sequence:CCGGCCCAGTAAGAATGCAACTTAACTCGAGTTAAGTTGCATTCTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-201s1c1
Sequence:CCGGCATCTGTAAGTGGTTCAACGTCTCGAGACGTTGAACCACTTACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-477s1c1
Sequence:CCGGCAAAGGAGACAGGTGCTACAACTCGAGTTGTAGCACCTGTCTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-360s1c1
Sequence:CCGGCACCTTTAAGAAGTCTGCCAACTCGAGTTGGCAGACTTCTTAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-543s1c1
Sequence:CCGGCCAGCCCAAGAAGTGCCACTTCTCGAGAAGTGGCACTTCTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145833
LIN28A MISSION shRNA Lentiviral Transduction Particles
lin-28 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145833.1-685s21c1
Sequence:CCGGCTCCCAGAAGCCCAGAATTGACTCGAGTCAATTCTGGGCTTCTGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-1029s21c1
Sequence:CCGGGAAGCGAAACAAGTGTCAAACCTCGAGGTTTGACACTTGTTTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145833.1-995s21c1
Sequence:CCGGTAGAAGGCTGTGTGATATTTCCTCGAGGAAATATCACACAGCCTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145833.1-2017s1c1
Sequence:CCGGCCCAGTAAGAATGCAACTTAACTCGAGTTAAGTTGCATTCTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-201s1c1
Sequence:CCGGCATCTGTAAGTGGTTCAACGTCTCGAGACGTTGAACCACTTACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-477s1c1
Sequence:CCGGCAAAGGAGACAGGTGCTACAACTCGAGTTGTAGCACCTGTCTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-360s1c1
Sequence:CCGGCACCTTTAAGAAGTCTGCCAACTCGAGTTGGCAGACTTCTTAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145833.1-543s1c1
Sequence:CCGGCCAGCCCAAGAAGTGCCACTTCTCGAGAAGTGGCACTTCTTGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)