EMAIL THIS PAGE TO A FRIEND

LIN28B

lin-28 homolog B (C. elegans)

258 Gene Product Result for
Synonyms: CSDD2
UniProtKB ID: Q6ZN17, A1L165, B2RPN6, Q5TCM4
Gene ID:
Human(389421) Summary: The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012]
Mouse(380669) lin-28 homolog B (C. elegans)
Rat(689054) lin-28 homolog B (C. elegans)
chicken(421786) lin-28 homolog B (C. elegans)
dog(481943) lin-28 homolog B (C. elegans)
cow(540646) lin-28 homolog B (C. elegans)
domestic cat(101090940) lin-28 homolog B (C. elegans)
sheep(100861578) lin-28 homolog B (C. elegans)
domestic guinea pig(100734141) lin-28 homolog B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001031772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004317 Rosetta Predictions human pricing
XM_001069344 Rosetta Predictions rat pricing
NM_001031772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042202 predicted 402
2 SASI_Hs01_00042203 predicted 650
3 SASI_Hs01_00042204 predicted 760
4 SASI_Hs01_00042206 predicted 943
5 SASI_Hs01_00042207 predicted 865
6 SASI_Hs01_00042208 predicted 569
7 SASI_Hs01_00042209 predicted 585
8 SASI_Hs02_00304534 predicted 761
9 SASI_Hs02_00304535 predicted 985
10 SASI_Hs02_00304536 predicted 641
11 SASI_Hs01_00042205 predicted 335
12 SASI_Hs01_00042210 predicted 376
13 SASI_Hs01_00042211 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327691 predicted 322
2 SASI_Rn02_00327692 predicted 246
3 SASI_Rn02_00327693 predicted 607
4 SASI_Rn02_00327694 predicted 224
5 SASI_Rn02_00327695 predicted 610
6 SASI_Rn02_00327696 predicted 218
7 SASI_Rn02_00327697 predicted 515
8 SASI_Rn02_00327698 predicted 420
9 SASI_Rn02_00327699 predicted 366
10 SASI_Rn02_00327700 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150693 predicted 333
2 SASI_Mm01_00150694 predicted 653
3 SASI_Mm01_00150695 predicted 947
4 SASI_Mm01_00150698 predicted 695
5 SASI_Mm01_00150699 predicted 286
6 SASI_Mm01_00150700 predicted 297
7 SASI_Mm02_00288155 predicted 299
8 SASI_Mm02_00288156 predicted 326
9 SASI_Mm01_00150701 predicted 862
10 SASI_Mm01_00150702 predicted 569
11 SASI_Mm01_00150696 predicted 310
12 SASI_Mm01_00150697 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004317
LIN28B MISSION shRNA Bacterial Glycerol Stock
lin-28 homolog B (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-482s1c1
Sequence:CCGGGCCTTGAGTCAATACGGGTAACTCGAGTTACCCGTATTGACTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2895s1c1
Sequence:CCGGGCAGGCATAATAAGCAAGTTACTCGAGTAACTTGCTTATTATGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2343s1c1
Sequence:CCGGGCCATAGTATTGGTCCTGTTACTCGAGTAACAGGACCAATACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-672s1c1
Sequence:CCGGCATCATGCACATGGTGGCAAACTCGAGTTTGCCACCATGTGCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-901s1c1
Sequence:CCGGGCACCAGAAGAGCAAAGCAAACTCGAGTTTGCTTTGCTCTTCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-300s1c1
Sequence:CCGGCCACTGTAAGTGGTTCAATGTCTCGAGACATTGAACCACTTACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-546s1c1
Sequence:CCGGCAAAGGGAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTCCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-521s1c1
Sequence:CCGGCCTGTTTAGGAAGTGAAAGAACTCGAGTTCTTTCACTTCCTAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-407s1c1
Sequence:CCGGACTATTCATGGAAGGATTTAGCTCGAGCTAAATCCTTCCATGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-952s1c1
Sequence:CCGGCATAACAGGTCTTCTTCATATCTCGAGATATGAAGAAGACCTGTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004317
LIN28B MISSION shRNA shRNA Plasmid DNA
lin-28 homolog B (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-482s1c1
Sequence:CCGGGCCTTGAGTCAATACGGGTAACTCGAGTTACCCGTATTGACTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2895s1c1
Sequence:CCGGGCAGGCATAATAAGCAAGTTACTCGAGTAACTTGCTTATTATGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2343s1c1
Sequence:CCGGGCCATAGTATTGGTCCTGTTACTCGAGTAACAGGACCAATACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-672s1c1
Sequence:CCGGCATCATGCACATGGTGGCAAACTCGAGTTTGCCACCATGTGCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-901s1c1
Sequence:CCGGGCACCAGAAGAGCAAAGCAAACTCGAGTTTGCTTTGCTCTTCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-300s1c1
Sequence:CCGGCCACTGTAAGTGGTTCAATGTCTCGAGACATTGAACCACTTACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-546s1c1
Sequence:CCGGCAAAGGGAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTCCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-521s1c1
Sequence:CCGGCCTGTTTAGGAAGTGAAAGAACTCGAGTTCTTTCACTTCCTAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-407s1c1
Sequence:CCGGACTATTCATGGAAGGATTTAGCTCGAGCTAAATCCTTCCATGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-952s1c1
Sequence:CCGGCATAACAGGTCTTCTTCATATCTCGAGATATGAAGAAGACCTGTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004317
LIN28B MISSION shRNA Lentiviral Transduction Particles
lin-28 homolog B (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-482s1c1
Sequence:CCGGGCCTTGAGTCAATACGGGTAACTCGAGTTACCCGTATTGACTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2895s1c1
Sequence:CCGGGCAGGCATAATAAGCAAGTTACTCGAGTAACTTGCTTATTATGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004317.1-2343s1c1
Sequence:CCGGGCCATAGTATTGGTCCTGTTACTCGAGTAACAGGACCAATACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-672s1c1
Sequence:CCGGCATCATGCACATGGTGGCAAACTCGAGTTTGCCACCATGTGCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-901s1c1
Sequence:CCGGGCACCAGAAGAGCAAAGCAAACTCGAGTTTGCTTTGCTCTTCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-300s1c1
Sequence:CCGGCCACTGTAAGTGGTTCAATGTCTCGAGACATTGAACCACTTACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.1-546s1c1
Sequence:CCGGCAAAGGGAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTCCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004317.1-521s1c1
Sequence:CCGGCCTGTTTAGGAAGTGAAAGAACTCGAGTTCTTTCACTTCCTAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-407s1c1
Sequence:CCGGACTATTCATGGAAGGATTTAGCTCGAGCTAAATCCTTCCATGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004317.2-952s1c1
Sequence:CCGGCATAACAGGTCTTCTTCATATCTCGAGATATGAAGAAGACCTGTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031772
LIN28B MISSION shRNA Bacterial Glycerol Stock
lin-28 homolog B (C. elegans)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000124708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-298s1c1
Sequence:CCGGCCCTTGGATATTCCAGTGGATCTCGAGATCCACTGGAATATCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-526s1c1
Sequence:CCGGCGGCAGGATTTACTGATGGATCTCGAGATCCATCAGTAAATCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-928s1c1
Sequence:CCGGCCTTTGATTCAGAAACGGAAACTCGAGTTTCCGTTTCTGAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-378s1c1
Sequence:CCGGGCCAGTGGAATTTACATTTAACTCGAGTTAAATGTAAATTCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031772
LIN28B MISSION shRNA shRNA Plasmid DNA
lin-28 homolog B (C. elegans)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000124708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-298s1c1
Sequence:CCGGCCCTTGGATATTCCAGTGGATCTCGAGATCCACTGGAATATCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-526s1c1
Sequence:CCGGCGGCAGGATTTACTGATGGATCTCGAGATCCATCAGTAAATCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-928s1c1
Sequence:CCGGCCTTTGATTCAGAAACGGAAACTCGAGTTTCCGTTTCTGAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-378s1c1
Sequence:CCGGGCCAGTGGAATTTACATTTAACTCGAGTTAAATGTAAATTCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031772
LIN28B MISSION shRNA Lentiviral Transduction Particles
lin-28 homolog B (C. elegans)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000124708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-298s1c1
Sequence:CCGGCCCTTGGATATTCCAGTGGATCTCGAGATCCACTGGAATATCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-526s1c1
Sequence:CCGGCGGCAGGATTTACTGATGGATCTCGAGATCCATCAGTAAATCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-928s1c1
Sequence:CCGGCCTTTGATTCAGAAACGGAAACTCGAGTTTCCGTTTCTGAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031772.1-378s1c1
Sequence:CCGGGCCAGTGGAATTTACATTTAACTCGAGTTAAATGTAAATTCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)