EMAIL THIS PAGE TO A FRIEND

LIN52

lin-52 homolog (C. elegans)

59 Gene Product Result for
Synonyms: C14orf46 c14_5549
UniProtKB ID: Q52LA3
Gene ID:
Mouse(217708) lin-52 homolog (C. elegans)
Rat(362763) lin-52 homolog (C. elegans)
sheep(101106081) lin-52 homolog (C. elegans)
domestic guinea pig(100721717) lin-52 homolog (C. elegans)
naked mole-rat(101703070) lin-52 homolog (C. elegans)
Zebrafish(777755) lin-52 homolog (C. elegans)
chicken(423346) lin-52 homolog (C. elegans)
domestic cat(101091027) lin-52 homolog (C. elegans)
cow(618104) lin-52 homolog (C. elegans)
dog(611889) lin-52 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024674 Rosetta Predictions human pricing
XM_001056671 Rosetta Predictions rat pricing
XM_343089 Rosetta Predictions rat pricing
NM_173756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127568 predicted 264
2 SASI_Hs01_00127569 predicted 319
3 SASI_Hs01_00127570 predicted 252
4 SASI_Hs01_00127571 predicted 247
5 SASI_Hs01_00127572 predicted 351
6 SASI_Hs01_00127573 predicted 200
7 SASI_Hs01_00127576 predicted 312
8 SASI_Hs01_00127577 predicted 279
9 SASI_Hs02_00307234 predicted 268
10 SASI_Hs02_00307235 predicted 235
11 SASI_Hs01_00127574 predicted 239
12 SASI_Hs01_00127575 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284009 predicted 647
2 SASI_Rn02_00284010 predicted 692
3 SASI_Rn02_00284011 predicted 549
4 SASI_Rn02_00284012 predicted 512
5 SASI_Rn02_00284013 predicted 342
6 SASI_Rn02_00284014 predicted 540
7 SASI_Rn02_00284015 predicted 327
8 SASI_Rn02_00284016 predicted 334
9 SASI_Rn02_00284017 predicted 602
10 SASI_Rn02_00284018 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395301 predicted 345
2 SASI_Rn02_00395302 predicted 478
3 SASI_Rn02_00395303 predicted 508
4 SASI_Rn02_00395304 predicted 342
5 SASI_Rn02_00395305 predicted 326
6 SASI_Rn02_00395306 predicted 332
7 SASI_Rn02_00395307 predicted 340
8 SASI_Rn02_00395308 predicted 354
9 SASI_Rn02_00395309 predicted 523
10 SASI_Rn02_00395310 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345401 predicted 570
2 SASI_Mm02_00345402 predicted 538
3 SASI_Mm02_00345403 predicted 699
4 SASI_Mm02_00345404 predicted 791
5 SASI_Mm02_00345405 predicted 493
6 SASI_Mm01_00074693 predicted 379
7 SASI_Mm01_00074694 predicted 643
8 SASI_Mm02_00345406 predicted 693
9 SASI_Mm01_00074697 predicted 796
10 SASI_Mm01_00074698 predicted 340
11 SASI_Mm01_00074689 predicted 705
12 SASI_Mm01_00074690 predicted 833
13 SASI_Mm01_00074691 predicted 674
14 SASI_Mm01_00074692 predicted 758
15 SASI_Mm01_00074695 predicted 689
16 SASI_Mm01_00074696 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024674
VALIDATED
LIN52 MISSION shRNA Bacterial Glycerol Stock
lin-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-123s21c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-208s1c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-395s1c1
Sequence:CCGGCACGGCTAATTTGATGGAGAACTCGAGTTCTCCATCAAATTAGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-386s1c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-280s1c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-264s1c1
Sequence:CCGGCCAGAACAATTACCAGGTGTTCTCGAGAACACCTGGTAATTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-84s21c1
Sequence:CCGGACCGTGCCTCACCAGATCTTTCTCGAGAAAGATCTGGTGAGGCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024674.2-844s21c1
Sequence:CCGGCTGTGAACTCTCCAGTATATACTCGAGTATATACTGGAGAGTTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-229s21c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-51s21c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024674
VALIDATED
LIN52 MISSION shRNA shRNA Plasmid DNA
lin-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-123s21c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-208s1c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-395s1c1
Sequence:CCGGCACGGCTAATTTGATGGAGAACTCGAGTTCTCCATCAAATTAGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-386s1c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-280s1c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-264s1c1
Sequence:CCGGCCAGAACAATTACCAGGTGTTCTCGAGAACACCTGGTAATTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-84s21c1
Sequence:CCGGACCGTGCCTCACCAGATCTTTCTCGAGAAAGATCTGGTGAGGCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024674.2-844s21c1
Sequence:CCGGCTGTGAACTCTCCAGTATATACTCGAGTATATACTGGAGAGTTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-229s21c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-51s21c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024674
VALIDATED
LIN52 MISSION shRNA Lentiviral Transduction Particles
lin-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-123s21c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-208s1c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-395s1c1
Sequence:CCGGCACGGCTAATTTGATGGAGAACTCGAGTTCTCCATCAAATTAGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-386s1c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024674.1-280s1c1
Sequence:CCGGGTGTTGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024674.1-264s1c1
Sequence:CCGGCCAGAACAATTACCAGGTGTTCTCGAGAACACCTGGTAATTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001024674.2-84s21c1
Sequence:CCGGACCGTGCCTCACCAGATCTTTCTCGAGAAAGATCTGGTGAGGCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024674.2-844s21c1
Sequence:CCGGCTGTGAACTCTCCAGTATATACTCGAGTATATACTGGAGAGTTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-229s21c1
Sequence:CCGGGAGTCTCACCACGGCTAATTTCTCGAGAAATTAGCCGTGGTGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024674.2-51s21c1
Sequence:CCGGTGGAAGCATCTTTGCTAAGTTCTCGAGAACTTAGCAAAGATGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173756
VALIDATED
LIN52 MISSION shRNA Bacterial Glycerol Stock
lin-52 homolog (C. elegans)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-112s1c1
Sequence:CCGGCTACCAGGTGTCGCTGAATTTCTCGAGAAATTCAGCGACACCTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-123s1c1
Sequence:CCGGCGCTGAATTTGCAGCTTCTTTCTCGAGAAAGAAGCTGCAAATTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-709s1c1
Sequence:CCGGGCGTTGTACTTGATCTCTTAACTCGAGTTAAGAGATCAAGTACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-604s1c1
Sequence:CCGGCCTGTCATTCTGAAAGGTATTCTCGAGAATACCTTTCAGAATGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-238s1c1
Sequence:CCGGGCTAACCTGATGGAGAAGGTACTCGAGTACCTTCTCCATCAGGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-119s1c1
Sequence:CCGGGTGTCGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173756.4-1223s1c1
Sequence:CCGGGATGCTTTGCTTATGTGATAACTCGAGTTATCACATAAGCAAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173756
VALIDATED
LIN52 MISSION shRNA shRNA Plasmid DNA
lin-52 homolog (C. elegans)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-112s1c1
Sequence:CCGGCTACCAGGTGTCGCTGAATTTCTCGAGAAATTCAGCGACACCTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-123s1c1
Sequence:CCGGCGCTGAATTTGCAGCTTCTTTCTCGAGAAAGAAGCTGCAAATTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-709s1c1
Sequence:CCGGGCGTTGTACTTGATCTCTTAACTCGAGTTAAGAGATCAAGTACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-604s1c1
Sequence:CCGGCCTGTCATTCTGAAAGGTATTCTCGAGAATACCTTTCAGAATGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-238s1c1
Sequence:CCGGGCTAACCTGATGGAGAAGGTACTCGAGTACCTTCTCCATCAGGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-119s1c1
Sequence:CCGGGTGTCGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173756.4-1223s1c1
Sequence:CCGGGATGCTTTGCTTATGTGATAACTCGAGTTATCACATAAGCAAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173756
VALIDATED
LIN52 MISSION shRNA Lentiviral Transduction Particles
lin-52 homolog (C. elegans)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-112s1c1
Sequence:CCGGCTACCAGGTGTCGCTGAATTTCTCGAGAAATTCAGCGACACCTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-123s1c1
Sequence:CCGGCGCTGAATTTGCAGCTTCTTTCTCGAGAAAGAAGCTGCAAATTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-709s1c1
Sequence:CCGGGCGTTGTACTTGATCTCTTAACTCGAGTTAAGAGATCAAGTACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-604s1c1
Sequence:CCGGCCTGTCATTCTGAAAGGTATTCTCGAGAATACCTTTCAGAATGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173756.2-238s1c1
Sequence:CCGGGCTAACCTGATGGAGAAGGTACTCGAGTACCTTCTCCATCAGGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173756.2-119s1c1
Sequence:CCGGGTGTCGCTGAATTTGCAGCTTCTCGAGAAGCTGCAAATTCAGCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173756.4-1223s1c1
Sequence:CCGGGATGCTTTGCTTATGTGATAACTCGAGTTATCACATAAGCAAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)