EMAIL THIS PAGE TO A FRIEND

LIN54

lin-54 homolog (C. elegans)

165 Gene Product Result for
Synonyms: CXCDC1 JC8.6 MIP120
UniProtKB ID: Q6MZP7, Q32M68, Q32M69, Q6N071, Q76B60
Gene ID:
Human(132660) Summary: LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]
Mouse(231506) lin-54 homolog (C. elegans)
Rat(305171) lin-54 homolog (C. elegans)
Zebrafish(560688) lin-54 homolog
cow(100139053) lin-54 homolog (C. elegans)
Horse(100052135) lin-54 homolog (C. elegans)
domestic cat(101085629) lin-54 homolog (C. elegans)
dog(478454) lin-54 homolog (C. elegans)
chicken(422595) lin-54 homolog (C. elegans)
domestic guinea pig(100735741) lin-54 homolog (C. elegans)
naked mole-rat(101718015) lin-54 homolog (C. elegans)
sheep(101116730) lin-54 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041171 MISSION® esiRNA esiRNA human LIN54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115007 Rosetta Predictions human pricing
NM_001115008 Rosetta Predictions human pricing
NM_194282 Rosetta Predictions human pricing
NM_001100564 Rosetta Predictions rat pricing
NM_001115010 Rosetta Predictions mouse pricing
NM_172714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326916 predicted 1379
2 SASI_Hs02_00326917 predicted 882
3 SASI_Hs02_00326918 predicted 1102
4 SASI_Hs02_00326919 predicted 988
5 SASI_Hs02_00326920 predicted 532
6 SASI_Hs02_00326921 predicted 1265
7 SASI_Hs02_00326922 predicted 1074
8 SASI_Hs02_00326923 predicted 1244
9 SASI_Hs02_00326924 predicted 1115
10 SASI_Hs02_00326925 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326926 predicted 1622
2 SASI_Hs02_00326927 predicted 1136
3 SASI_Hs02_00326928 predicted 1354
4 SASI_Hs02_00326929 predicted 1238
5 SASI_Hs02_00326930 predicted 775
6 SASI_Hs02_00326931 predicted 1508
7 SASI_Hs02_00326932 predicted 1327
8 SASI_Hs02_00326933 predicted 1489
9 SASI_Hs02_00326934 predicted 1358
10 SASI_Hs02_00326935 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165933 predicted 2292
2 SASI_Hs02_00371405 predicted 1800
3 SASI_Hs02_00371406 predicted 2014
4 SASI_Hs01_00165935 predicted 1907
5 SASI_Hs01_00165936 predicted 1441
6 SASI_Hs01_00165937 predicted 2172
7 SASI_Hs02_00371407 predicted 1990
8 SASI_Hs01_00165939 predicted 2150
9 SASI_Hs02_00371408 predicted 2025
10 SASI_Hs02_00371409 predicted 2353
11 SASI_Hs01_00165934 predicted 1033
12 SASI_Hs01_00165938 predicted 2620
13 SASI_Hs01_00165940 predicted 567
14 SASI_Hs01_00165941 predicted 1645
15 SASI_Hs01_00165942 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210068 predicted 1948
2 SASI_Rn02_00210069 predicted 1674
3 SASI_Rn02_00210070 predicted 936
4 SASI_Rn02_00210071 predicted 440
5 SASI_Rn02_00210072 predicted 217
6 SASI_Rn02_00210073 predicted 1728
7 SASI_Rn02_00210074 predicted 461
8 SASI_Rn02_00210075 predicted 1016
9 SASI_Rn02_00210076 predicted 1091
10 SASI_Rn02_00210077 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308867 predicted 2219
2 SASI_Mm02_00308868 predicted 1957
3 SASI_Mm02_00308869 predicted 1206
4 SASI_Mm02_00308870 predicted 1016
5 SASI_Mm02_00308871 predicted 1227
6 SASI_Mm02_00308872 predicted 2484
7 SASI_Mm02_00308873 predicted 877
8 SASI_Mm02_00308874 predicted 1176
9 SASI_Mm02_00308875 predicted 489
10 SASI_Mm02_00308876 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139683 predicted 2090
2 SASI_Mm01_00139684 predicted 1824
3 SASI_Mm02_00344493 predicted 1071
4 SASI_Mm02_00344494 predicted 888
5 SASI_Mm02_00344495 predicted 1094
6 SASI_Mm01_00139687 predicted 2346
7 SASI_Mm02_00344496 predicted 747
8 SASI_Mm02_00344497 predicted 1047
9 SASI_Mm02_00344498 predicted 351
10 SASI_Mm02_00344499 predicted 496
11 SASI_Mm01_00139685 predicted 690
12 SASI_Mm01_00139686 predicted 1019
13 SASI_Mm01_00139688 predicted 1205
14 SASI_Mm01_00139689 predicted 1318
15 SASI_Mm01_00139690 predicted 660
16 SASI_Mm01_00139691 predicted 1062
17 SASI_Mm01_00139692 predicted 1665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194282
LIN54 MISSION shRNA Bacterial Glycerol Stock
lin-54 homolog (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-1307s21c1
Sequence:CCGGCACCTTTGAAATCGCCAAATACTCGAGTATTTGGCGATTTCAAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-542s21c1
Sequence:CCGGACTCTACAGCCACGCCCATTTCTCGAGAAATGGGCGTGGCTGTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-2159s21c1
Sequence:CCGGGTCATAGCAAAGGGTGTAATTCTCGAGAATTACACCCTTTGCTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194282.1-3037s1c1
Sequence:CCGGGCAGACAGAATGTTACATAAACTCGAGTTTATGTAACATTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-697s1c1
Sequence:CCGGCCTGTGACTATATCAGCCAATCTCGAGATTGGCTGATATAGTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-2118s1c1
Sequence:CCGGGCCTAAGATAGGGAAAGGAAACTCGAGTTTCCTTTCCCTATCTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1414s1c1
Sequence:CCGGCCCAATGTCCAGCAGATTCAACTCGAGTTGAATCTGCTGGACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1894s1c1
Sequence:CCGGCGGCTTCCATTCAATGGCATACTCGAGTATGCCATTGAATGGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194282
LIN54 MISSION shRNA shRNA Plasmid DNA
lin-54 homolog (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-1307s21c1
Sequence:CCGGCACCTTTGAAATCGCCAAATACTCGAGTATTTGGCGATTTCAAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-542s21c1
Sequence:CCGGACTCTACAGCCACGCCCATTTCTCGAGAAATGGGCGTGGCTGTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-2159s21c1
Sequence:CCGGGTCATAGCAAAGGGTGTAATTCTCGAGAATTACACCCTTTGCTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194282.1-3037s1c1
Sequence:CCGGGCAGACAGAATGTTACATAAACTCGAGTTTATGTAACATTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-697s1c1
Sequence:CCGGCCTGTGACTATATCAGCCAATCTCGAGATTGGCTGATATAGTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-2118s1c1
Sequence:CCGGGCCTAAGATAGGGAAAGGAAACTCGAGTTTCCTTTCCCTATCTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1414s1c1
Sequence:CCGGCCCAATGTCCAGCAGATTCAACTCGAGTTGAATCTGCTGGACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1894s1c1
Sequence:CCGGCGGCTTCCATTCAATGGCATACTCGAGTATGCCATTGAATGGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194282
LIN54 MISSION shRNA Lentiviral Transduction Particles
lin-54 homolog (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-1307s21c1
Sequence:CCGGCACCTTTGAAATCGCCAAATACTCGAGTATTTGGCGATTTCAAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-542s21c1
Sequence:CCGGACTCTACAGCCACGCCCATTTCTCGAGAAATGGGCGTGGCTGTAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194282.2-2159s21c1
Sequence:CCGGGTCATAGCAAAGGGTGTAATTCTCGAGAATTACACCCTTTGCTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194282.1-3037s1c1
Sequence:CCGGGCAGACAGAATGTTACATAAACTCGAGTTTATGTAACATTCTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-697s1c1
Sequence:CCGGCCTGTGACTATATCAGCCAATCTCGAGATTGGCTGATATAGTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-2118s1c1
Sequence:CCGGGCCTAAGATAGGGAAAGGAAACTCGAGTTTCCTTTCCCTATCTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1414s1c1
Sequence:CCGGCCCAATGTCCAGCAGATTCAACTCGAGTTGAATCTGCTGGACATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194282.1-1894s1c1
Sequence:CCGGCGGCTTCCATTCAATGGCATACTCGAGTATGCCATTGAATGGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172714
VALIDATED
LIN54 MISSION shRNA Bacterial Glycerol Stock
lin-54 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172714.1-2143s1c1
Sequence:CCGGCCTGATTCTATTGACAAAGAACTCGAGTTCTTTGTCAATAGAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1135s1c1
Sequence:CCGGGCTTCCATTCAATGGCATAATCTCGAGATTATGCCATTGAATGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1346s1c1
Sequence:CCGGGAAGCCTTCAAGCCAAAGATACTCGAGTATCTTTGGCTTGAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-849s1c1
Sequence:CCGGCCGTTAAGCAAGTTGTTCCAACTCGAGTTGGAACAACTTGCTTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1669s1c1
Sequence:CCGGGCCGTTTACATTTGTAACTAACTCGAGTTAGTTACAAATGTAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172714
VALIDATED
LIN54 MISSION shRNA shRNA Plasmid DNA
lin-54 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172714.1-2143s1c1
Sequence:CCGGCCTGATTCTATTGACAAAGAACTCGAGTTCTTTGTCAATAGAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1135s1c1
Sequence:CCGGGCTTCCATTCAATGGCATAATCTCGAGATTATGCCATTGAATGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1346s1c1
Sequence:CCGGGAAGCCTTCAAGCCAAAGATACTCGAGTATCTTTGGCTTGAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-849s1c1
Sequence:CCGGCCGTTAAGCAAGTTGTTCCAACTCGAGTTGGAACAACTTGCTTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1669s1c1
Sequence:CCGGGCCGTTTACATTTGTAACTAACTCGAGTTAGTTACAAATGTAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172714
VALIDATED
LIN54 MISSION shRNA Lentiviral Transduction Particles
lin-54 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172714.1-2143s1c1
Sequence:CCGGCCTGATTCTATTGACAAAGAACTCGAGTTCTTTGTCAATAGAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1135s1c1
Sequence:CCGGGCTTCCATTCAATGGCATAATCTCGAGATTATGCCATTGAATGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1346s1c1
Sequence:CCGGGAAGCCTTCAAGCCAAAGATACTCGAGTATCTTTGGCTTGAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-849s1c1
Sequence:CCGGCCGTTAAGCAAGTTGTTCCAACTCGAGTTGGAACAACTTGCTTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172714.1-1669s1c1
Sequence:CCGGGCCGTTTACATTTGTAACTAACTCGAGTTAGTTACAAATGTAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)