EMAIL THIS PAGE TO A FRIEND

LIN7A

lin-7 homolog A (C. elegans)

89 Gene Product Result for
Synonyms: LIN-7A LIN7 MALS-1 TIP-33 VELI1
UniProtKB ID: O14910, A4FTY3, Q147W1, Q6LES3, Q7LDS4
Gene ID:
Mouse(108030) lin-7 homolog A (C. elegans)
Rat(85327) lin-7 homolog a (C. elegans)
sheep(101104472) lin-7 homolog A (C. elegans)
domestic guinea pig(100734465) lin-7 homolog A (C. elegans)
naked mole-rat(101717859) lin-7 homolog A (C. elegans)
Zebrafish(393682) lin-7 homolog A (C. elegans)
chicken(417874) lin-7 homolog A (C. elegans)
cow(528379) lin-7 homolog A (C. elegans)
domestic cat(101091291) lin-7 homolog A (C. elegans)
dog(475412) lin-7 homolog A (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_193582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004664 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045511 MISSION® esiRNA esiRNA human LIN7A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004664 Rosetta Predictions human pricing
NM_053514 Rosetta Predictions rat pricing
NM_001033223 Rosetta Predictions mouse pricing
NM_001039354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127668 predicted 432
2 SASI_Hs01_00127669 predicted 501
3 SASI_Hs01_00127670 predicted 500
4 SASI_Hs01_00127671 predicted 378
5 SASI_Hs02_00338084 predicted 438
6 SASI_Hs01_00127672 predicted 387
7 SASI_Hs02_00338085 predicted 444
8 SASI_Hs01_00127674 predicted 414
9 SASI_Hs01_00127675 predicted 532
10 SASI_Hs01_00127677 predicted 382
11 SASI_Hs01_00127673 predicted 581
12 SASI_Hs01_00127676 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031346 predicted 257
2 SASI_Rn01_00031347 predicted 206
3 SASI_Rn01_00031348 predicted 265
4 SASI_Rn01_00031349 predicted 336
5 SASI_Rn01_00031352 predicted 296
6 SASI_Rn01_00031353 predicted 344
7 SASI_Rn01_00031354 predicted 335
8 SASI_Rn01_00031355 predicted 213
9 SASI_Rn02_00266122 predicted 346
10 SASI_Rn02_00266123 predicted 326
11 SASI_Rn01_00031350 predicted 279
12 SASI_Rn01_00031351 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072454 predicted 1011
2 SASI_Mm01_00072455 predicted 781
3 SASI_Mm01_00072456 predicted 1089
4 SASI_Mm01_00072458 predicted 1067
5 SASI_Mm01_00072459 predicted 377
6 SASI_Mm01_00072460 predicted 966
7 SASI_Mm01_00072461 predicted 676
8 SASI_Mm01_00072462 predicted 836
9 SASI_Mm02_00288348 predicted 1018
10 SASI_Mm02_00288349 predicted 983
11 SASI_Mm01_00072457 predicted 1192
12 SASI_Mm01_00072463 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045842 predicted 1054
2 SASI_Mm01_00045843 predicted 824
3 SASI_Mm01_00045844 predicted 412
4 SASI_Mm01_00045845 predicted 1015
5 SASI_Mm01_00045846 predicted 873
6 SASI_Mm01_00045847 predicted 828
7 SASI_Mm01_00045848 predicted 369
8 SASI_Mm01_00045849 predicted 1030
9 SASI_Mm01_00045850 predicted 1019
10 SASI_Mm01_00045851 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193582
LIN7A MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_193582.5-1590s1c1
Sequence:CCGGCCATTCGTTACCAAGGCAATTCTCGAGAATTGCCTTGGTAACGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1140s1c1
Sequence:CCGGGATTTACATCTCCCGCATCATCTCGAGATGATGCGGGAGATGTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1213s1c1
Sequence:CCGGCTATCAGTGAACGGAGTGAGTCTCGAGACTCACTCCGTTCACTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1415s1c1
Sequence:CCGGAGCAACAACAACCACAACAAACTCGAGTTTGTTGTGGTTGTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1246s1c1
Sequence:CCGGCACCATGAGAAAGCTGTGGAACTCGAGTTCCACAGCTTTCTCATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193582
LIN7A MISSION shRNA shRNA Plasmid DNA
lin-7 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_193582.5-1590s1c1
Sequence:CCGGCCATTCGTTACCAAGGCAATTCTCGAGAATTGCCTTGGTAACGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1140s1c1
Sequence:CCGGGATTTACATCTCCCGCATCATCTCGAGATGATGCGGGAGATGTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1213s1c1
Sequence:CCGGCTATCAGTGAACGGAGTGAGTCTCGAGACTCACTCCGTTCACTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1415s1c1
Sequence:CCGGAGCAACAACAACCACAACAAACTCGAGTTTGTTGTGGTTGTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1246s1c1
Sequence:CCGGCACCATGAGAAAGCTGTGGAACTCGAGTTCCACAGCTTTCTCATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193582
LIN7A MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_193582.5-1590s1c1
Sequence:CCGGCCATTCGTTACCAAGGCAATTCTCGAGAATTGCCTTGGTAACGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1140s1c1
Sequence:CCGGGATTTACATCTCCCGCATCATCTCGAGATGATGCGGGAGATGTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1213s1c1
Sequence:CCGGCTATCAGTGAACGGAGTGAGTCTCGAGACTCACTCCGTTCACTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1415s1c1
Sequence:CCGGAGCAACAACAACCACAACAAACTCGAGTTTGTTGTGGTTGTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193582.5-1246s1c1
Sequence:CCGGCACCATGAGAAAGCTGTGGAACTCGAGTTCCACAGCTTTCTCATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004664
LIN7A MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog A (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-710s1c1
Sequence:CCGGGAACTACTCAAGGCTGCTAAACTCGAGTTTAGCAGCCTTGAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004664.2-952s1c1
Sequence:CCGGGCTTCAGAATCCCAGCACATACTCGAGTATGTGCTGGGATTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-409s1c1
Sequence:CCGGGCATGAAACGATAACTGTTAACTCGAGTTAACAGTTATCGTTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-584s1c1
Sequence:CCGGCCCATTTATATCTCTCGCATACTCGAGTATGCGAGAGATATAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-335s1c1
Sequence:CCGGCACAAGCTACAATCCCTCAAACTCGAGTTTGAGGGATTGTAGCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-978s21c1
Sequence:CCGGAGACAACACTGATAATTATACCTCGAGGTATAATTATCAGTGTTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004664.2-512s21c1
Sequence:CCGGCGAGTAGTTGAACTGCCAAAGCTCGAGCTTTGGCAGTTCAACTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-904s21c1
Sequence:CCGGGGGAAAGCTACTTGATCAAACCTCGAGGTTTGATCAAGTAGCTTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004664
LIN7A MISSION shRNA shRNA Plasmid DNA
lin-7 homolog A (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-710s1c1
Sequence:CCGGGAACTACTCAAGGCTGCTAAACTCGAGTTTAGCAGCCTTGAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004664.2-952s1c1
Sequence:CCGGGCTTCAGAATCCCAGCACATACTCGAGTATGTGCTGGGATTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-409s1c1
Sequence:CCGGGCATGAAACGATAACTGTTAACTCGAGTTAACAGTTATCGTTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-584s1c1
Sequence:CCGGCCCATTTATATCTCTCGCATACTCGAGTATGCGAGAGATATAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-335s1c1
Sequence:CCGGCACAAGCTACAATCCCTCAAACTCGAGTTTGAGGGATTGTAGCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-978s21c1
Sequence:CCGGAGACAACACTGATAATTATACCTCGAGGTATAATTATCAGTGTTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004664.2-512s21c1
Sequence:CCGGCGAGTAGTTGAACTGCCAAAGCTCGAGCTTTGGCAGTTCAACTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-904s21c1
Sequence:CCGGGGGAAAGCTACTTGATCAAACCTCGAGGTTTGATCAAGTAGCTTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004664
LIN7A MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog A (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-710s1c1
Sequence:CCGGGAACTACTCAAGGCTGCTAAACTCGAGTTTAGCAGCCTTGAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004664.2-952s1c1
Sequence:CCGGGCTTCAGAATCCCAGCACATACTCGAGTATGTGCTGGGATTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-409s1c1
Sequence:CCGGGCATGAAACGATAACTGTTAACTCGAGTTAACAGTTATCGTTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-584s1c1
Sequence:CCGGCCCATTTATATCTCTCGCATACTCGAGTATGCGAGAGATATAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004664.2-335s1c1
Sequence:CCGGCACAAGCTACAATCCCTCAAACTCGAGTTTGAGGGATTGTAGCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-978s21c1
Sequence:CCGGAGACAACACTGATAATTATACCTCGAGGTATAATTATCAGTGTTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004664.2-512s21c1
Sequence:CCGGCGAGTAGTTGAACTGCCAAAGCTCGAGCTTTGGCAGTTCAACTACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004664.2-904s21c1
Sequence:CCGGGGGAAAGCTACTTGATCAAACCTCGAGGTTTGATCAAGTAGCTTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)