EMAIL THIS PAGE TO A FRIEND

LIN7B

lin-7 homolog B (C. elegans)

60 Gene Product Result for
Synonyms: LIN-7B MALS-2 MALS2 VELI2
UniProtKB ID: Q9HAP6
Gene ID:
Mouse(22342) lin-7 homolog B (C. elegans)
Rat(60377) lin-7 homolog b (C. elegans)
Zebrafish(553768) lin-7 homolog B (C. elegans)
cow(616283) lin-7 homolog B (C. elegans)
domestic cat(101099918) lin-7 homolog B (C. elegans)
chicken(421608) lin-7 homolog B (C. elegans)
dog(476417) lin-7 homolog B (C. elegans)
domestic guinea pig(100729334) lin-7 homolog B (C. elegans)
naked mole-rat(101709484) lin-7 homolog B (C. elegans)
sheep(101109560) lin-7 homolog B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050921 MISSION® esiRNA esiRNA human LIN7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022165 Rosetta Predictions human pricing
NM_021758 Rosetta Predictions rat pricing
NM_011698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131357 predicted 387
2 SASI_Hs01_00131358 predicted 316
3 SASI_Hs01_00131359 predicted 454
4 SASI_Hs01_00131360 predicted 340
5 SASI_Hs01_00131361 predicted 464
6 SASI_Hs01_00131362 predicted 244
7 SASI_Hs01_00131363 predicted 464
8 SASI_Hs01_00131364 predicted 308
9 SASI_Hs01_00131365 predicted 208
10 SASI_Hs01_00131366 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061704 predicted 341
2 SASI_Rn01_00061705 predicted 286
3 SASI_Rn01_00061706 predicted 276
4 SASI_Rn01_00061707 predicted 227
5 SASI_Rn02_00262817 predicted 324
6 SASI_Rn01_00061708 predicted 197
7 SASI_Rn01_00061710 predicted 258
8 SASI_Rn01_00061711 predicted 265
9 SASI_Rn01_00061712 predicted 281
10 SASI_Rn02_00262818 predicted 249
11 SASI_Rn01_00061703 predicted 341
12 SASI_Rn01_00061709 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084067 predicted 301
2 SASI_Mm01_00084068 predicted 300
3 SASI_Mm01_00084069 predicted 293
4 SASI_Mm01_00084070 predicted 348
5 SASI_Mm01_00084071 predicted 424
6 SASI_Mm01_00084072 predicted 352
7 SASI_Mm01_00084073 predicted 282
8 SASI_Mm01_00084074 predicted 433
9 SASI_Mm01_00084075 predicted 301
10 SASI_Mm01_00084076 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022165
LIN7B MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog B (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-488s21c1
Sequence:CCGGTGAGGGTGAGCAGCATGAGAACTCGAGTTCTCATGCTGCTCACCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-637s21c1
Sequence:CCGGAGAGCTACTCGTCCTTGGAGTCTCGAGACTCCAAGGACGAGTAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-455s21c1
Sequence:CCGGGGATCAACTGTTGTCGGTGAACTCGAGTTCACCGACAACAGTTGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-163s21c1
Sequence:CCGGGAGTTCTGCAGAGCCGCTTCTCTCGAGAGAAGCGGCTCTGCAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-212s1c1
Sequence:CCGGGCTTTATGACACGCTGGACATCTCGAGATGTCCAGCGTGTCATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-594s1c1
Sequence:CCGGCGGTTCGAGAAGATGCGCTCTCTCGAGAGAGCGCATCTTCTCGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-541s1c1
Sequence:CCGGCGGTGAAGCTGGTTGTCCGTTCTCGAGAACGGACAACCAGCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-198s1c1
Sequence:CCGGGAGGTGTATGAGCAGCTTTATCTCGAGATAAAGCTGCTCATACACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022165
LIN7B MISSION shRNA shRNA Plasmid DNA
lin-7 homolog B (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-488s21c1
Sequence:CCGGTGAGGGTGAGCAGCATGAGAACTCGAGTTCTCATGCTGCTCACCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-637s21c1
Sequence:CCGGAGAGCTACTCGTCCTTGGAGTCTCGAGACTCCAAGGACGAGTAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-455s21c1
Sequence:CCGGGGATCAACTGTTGTCGGTGAACTCGAGTTCACCGACAACAGTTGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-163s21c1
Sequence:CCGGGAGTTCTGCAGAGCCGCTTCTCTCGAGAGAAGCGGCTCTGCAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-212s1c1
Sequence:CCGGGCTTTATGACACGCTGGACATCTCGAGATGTCCAGCGTGTCATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-594s1c1
Sequence:CCGGCGGTTCGAGAAGATGCGCTCTCTCGAGAGAGCGCATCTTCTCGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-541s1c1
Sequence:CCGGCGGTGAAGCTGGTTGTCCGTTCTCGAGAACGGACAACCAGCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-198s1c1
Sequence:CCGGGAGGTGTATGAGCAGCTTTATCTCGAGATAAAGCTGCTCATACACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022165
LIN7B MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog B (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-488s21c1
Sequence:CCGGTGAGGGTGAGCAGCATGAGAACTCGAGTTCTCATGCTGCTCACCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-637s21c1
Sequence:CCGGAGAGCTACTCGTCCTTGGAGTCTCGAGACTCCAAGGACGAGTAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-455s21c1
Sequence:CCGGGGATCAACTGTTGTCGGTGAACTCGAGTTCACCGACAACAGTTGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022165.2-163s21c1
Sequence:CCGGGAGTTCTGCAGAGCCGCTTCTCTCGAGAGAAGCGGCTCTGCAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-212s1c1
Sequence:CCGGGCTTTATGACACGCTGGACATCTCGAGATGTCCAGCGTGTCATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-594s1c1
Sequence:CCGGCGGTTCGAGAAGATGCGCTCTCTCGAGAGAGCGCATCTTCTCGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-541s1c1
Sequence:CCGGCGGTGAAGCTGGTTGTCCGTTCTCGAGAACGGACAACCAGCTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022165.2-198s1c1
Sequence:CCGGGAGGTGTATGAGCAGCTTTATCTCGAGATAAAGCTGCTCATACACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011698
LIN7B MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-160s1c1
Sequence:CCGGGAGGTGTATGAACAGCTCTATCTCGAGATAGAGCTGTTCATACACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-303s1c1
Sequence:CCGGTGATGAGGGTTTGGGCTTCAACTCGAGTTGAAGCCCAAACCCTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-318s1c1
Sequence:CCGGCTTCAACATCATGGGTGGCAACTCGAGTTGCCACCCATGATGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-354s1c1
Sequence:CCGGCATCTATATCTCTCGAGTCATCTCGAGATGACTCGAGAGATATAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-556s1c1
Sequence:CCGGCGCTTCGAGAAGATGCGATCTCTCGAGAGATCGCATCTTCTCGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011698
LIN7B MISSION shRNA shRNA Plasmid DNA
lin-7 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-160s1c1
Sequence:CCGGGAGGTGTATGAACAGCTCTATCTCGAGATAGAGCTGTTCATACACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-303s1c1
Sequence:CCGGTGATGAGGGTTTGGGCTTCAACTCGAGTTGAAGCCCAAACCCTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-318s1c1
Sequence:CCGGCTTCAACATCATGGGTGGCAACTCGAGTTGCCACCCATGATGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-354s1c1
Sequence:CCGGCATCTATATCTCTCGAGTCATCTCGAGATGACTCGAGAGATATAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-556s1c1
Sequence:CCGGCGCTTCGAGAAGATGCGATCTCTCGAGAGATCGCATCTTCTCGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011698
LIN7B MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-160s1c1
Sequence:CCGGGAGGTGTATGAACAGCTCTATCTCGAGATAGAGCTGTTCATACACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-303s1c1
Sequence:CCGGTGATGAGGGTTTGGGCTTCAACTCGAGTTGAAGCCCAAACCCTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-318s1c1
Sequence:CCGGCTTCAACATCATGGGTGGCAACTCGAGTTGCCACCCATGATGTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-354s1c1
Sequence:CCGGCATCTATATCTCTCGAGTCATCTCGAGATGACTCGAGAGATATAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011698.1-556s1c1
Sequence:CCGGCGCTTCGAGAAGATGCGATCTCTCGAGAGATCGCATCTTCTCGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)