EMAIL THIS PAGE TO A FRIEND

LIN7C

lin-7 homolog C (C. elegans)

213 Gene Product Result for
Synonyms: LIN-7-C LIN-7C MALS-3 MALS3 VELI3
UniProtKB ID: Q9NUP9
Gene ID:
Mouse(22343) lin-7 homolog C (C. elegans)
Rat(60442) lin-7 homolog C (C. elegans)
sheep(101116761) lin-7 homolog C (C. elegans)
domestic guinea pig(100729709) lin-7 homolog C (C. elegans)
naked mole-rat(101703493) lin-7 homolog C (C. elegans)
Zebrafish(447934) lin-7 homolog C (C. elegans)
dog(485424) lin-7 homolog C (C. elegans)
cow(510125) lin-7 homolog C (C. elegans)
domestic cat(101082691) lin-7 homolog C (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101347 Anti-LIN7C (ab1) antibody produced in rabbit affinity isolated antibody rat, canine, pig, guinea pig, horse, zebrafish, mouse, bovine, rabbit, human,
immunohistochemistry, western blot pricing
SAB2101348 Anti-LIN7C (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, bovine, mouse, canine, rabbit, human, zebrafish, rat
immunohistochemistry, western blot pricing
HPA051118 Anti-LIN7C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018362 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018362 Rosetta Predictions human pricing
NM_021851 Rosetta Predictions rat pricing
NM_011699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093158 predicted 579
2 SASI_Hs01_00093159 predicted 508
3 SASI_Hs01_00093160 predicted 483
4 SASI_Hs01_00093161 predicted 583
5 SASI_Hs01_00093162 predicted 205
6 SASI_Hs01_00093163 predicted 582
7 SASI_Hs01_00093164 predicted 272
8 SASI_Hs01_00093165 predicted 355
9 SASI_Hs01_00093166 predicted 436
10 SASI_Hs01_00093167 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053643 predicted 341
2 SASI_Rn02_00262878 predicted 298
3 SASI_Rn01_00053644 predicted 226
4 SASI_Rn01_00053645 predicted 338
5 SASI_Rn01_00053647 predicted 353
6 SASI_Rn01_00053648 predicted 199
7 SASI_Rn01_00053649 predicted 198
8 SASI_Rn01_00053650 predicted 225
9 SASI_Rn01_00053651 predicted 202
10 SASI_Rn01_00053652 predicted 241
11 SASI_Rn01_00053646 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107841 predicted 960
2 SASI_Mm01_00107842 predicted 419
3 SASI_Mm01_00107843 predicted 577
4 SASI_Mm01_00107844 predicted 742
5 SASI_Mm01_00107845 predicted 853
6 SASI_Mm01_00107846 predicted 351
7 SASI_Mm01_00107848 predicted 202
8 SASI_Mm01_00107849 predicted 944
9 SASI_Mm02_00321257 predicted 934
10 SASI_Mm01_00107850 predicted 366
11 SASI_Mm01_00107847 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011699
VALIDATED
LIN7C MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-2279s1c1
Sequence:CCGGCCGTTATTGTTATGCTCGTATCTCGAGATACGAGCATAACAATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-214s1c1
Sequence:CCGGGAGAGCCAATGCAACTGCAAACTCGAGTTTGCAGTTGCATTGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011699.2-224s1c1
Sequence:CCGGGCAACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-367s1c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-494s1c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-308s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-367s21c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-494s21c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-587s21c1
Sequence:CCGGAGACAACAGACCTAATCATTTCTCGAGAAATGATTAGGTCTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011699.3-739s21c1
Sequence:CCGGTTAGCATCACTTATGGTTATACTCGAGTATAACCATAAGTGATGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011699
VALIDATED
LIN7C MISSION shRNA shRNA Plasmid DNA
lin-7 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-2279s1c1
Sequence:CCGGCCGTTATTGTTATGCTCGTATCTCGAGATACGAGCATAACAATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-214s1c1
Sequence:CCGGGAGAGCCAATGCAACTGCAAACTCGAGTTTGCAGTTGCATTGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011699.2-224s1c1
Sequence:CCGGGCAACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-367s1c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-494s1c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-308s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-367s21c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-494s21c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-587s21c1
Sequence:CCGGAGACAACAGACCTAATCATTTCTCGAGAAATGATTAGGTCTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011699.3-739s21c1
Sequence:CCGGTTAGCATCACTTATGGTTATACTCGAGTATAACCATAAGTGATGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011699
VALIDATED
LIN7C MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-2279s1c1
Sequence:CCGGCCGTTATTGTTATGCTCGTATCTCGAGATACGAGCATAACAATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-214s1c1
Sequence:CCGGGAGAGCCAATGCAACTGCAAACTCGAGTTTGCAGTTGCATTGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011699.2-224s1c1
Sequence:CCGGGCAACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-367s1c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011699.2-494s1c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-308s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-367s21c1
Sequence:CCGGGCGGATAATTCCAGGTGGAATCTCGAGATTCCACCTGGAATTATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-494s21c1
Sequence:CCGGGCCCAAGGGAAGGTTAAATTACTCGAGTAATTTAACCTTCCCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011699.3-587s21c1
Sequence:CCGGAGACAACAGACCTAATCATTTCTCGAGAAATGATTAGGTCTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011699.3-739s21c1
Sequence:CCGGTTAGCATCACTTATGGTTATACTCGAGTATAACCATAAGTGATGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018362
VALIDATED
LIN7C MISSION shRNA Bacterial Glycerol Stock
lin-7 homolog C (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-3705s1c1
Sequence:CCGGGCAGCCTAGTTCTTTAGGATTCTCGAGAATCCTAAAGAACTAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-221s1c1
Sequence:CCGGGCTACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-365s1c1
Sequence:CCGGCGAATAATTCCAGGTGGAATTCTCGAGAATTCCACCTGGAATTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-149s1c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018362.2-363s1c1
Sequence:CCGGCCCGAATAATTCCAGGTGGAACTCGAGTTCCACCTGGAATTATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-70s21c1
Sequence:CCGGTGTAGAGCAATTGAATTATTGCTCGAGCAATAATTCAATTGCTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-604s21c1
Sequence:CCGGCGCAGGCAACAGACCTAATACCTCGAGGTATTAGGTCTGTTGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-172s21c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-511s21c1
Sequence:CCGGGCCGCACAAGGAAAGGTTAAACTCGAGTTTAACCTTTCCTTGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-328s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018362
VALIDATED
LIN7C MISSION shRNA shRNA Plasmid DNA
lin-7 homolog C (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-3705s1c1
Sequence:CCGGGCAGCCTAGTTCTTTAGGATTCTCGAGAATCCTAAAGAACTAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-221s1c1
Sequence:CCGGGCTACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-365s1c1
Sequence:CCGGCGAATAATTCCAGGTGGAATTCTCGAGAATTCCACCTGGAATTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-149s1c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018362.2-363s1c1
Sequence:CCGGCCCGAATAATTCCAGGTGGAACTCGAGTTCCACCTGGAATTATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-70s21c1
Sequence:CCGGTGTAGAGCAATTGAATTATTGCTCGAGCAATAATTCAATTGCTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-604s21c1
Sequence:CCGGCGCAGGCAACAGACCTAATACCTCGAGGTATTAGGTCTGTTGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-172s21c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-511s21c1
Sequence:CCGGGCCGCACAAGGAAAGGTTAAACTCGAGTTTAACCTTTCCTTGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-328s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018362
VALIDATED
LIN7C MISSION shRNA Lentiviral Transduction Particles
lin-7 homolog C (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-3705s1c1
Sequence:CCGGGCAGCCTAGTTCTTTAGGATTCTCGAGAATCCTAAAGAACTAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-221s1c1
Sequence:CCGGGCTACTGCAAAGGCTACTGTTCTCGAGAACAGTAGCCTTTGCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-365s1c1
Sequence:CCGGCGAATAATTCCAGGTGGAATTCTCGAGAATTCCACCTGGAATTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018362.2-149s1c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018362.2-363s1c1
Sequence:CCGGCCCGAATAATTCCAGGTGGAACTCGAGTTCCACCTGGAATTATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-70s21c1
Sequence:CCGGTGTAGAGCAATTGAATTATTGCTCGAGCAATAATTCAATTGCTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-604s21c1
Sequence:CCGGCGCAGGCAACAGACCTAATACCTCGAGGTATTAGGTCTGTTGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-172s21c1
Sequence:CCGGGCTGTGAGAGAGGTATATGAACTCGAGTTCATATACCTCTCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-511s21c1
Sequence:CCGGGCCGCACAAGGAAAGGTTAAACTCGAGTTTAACCTTTCCTTGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018362.3-328s21c1
Sequence:CCGGGAGGGCCTTGGATTCAATATTCTCGAGAATATTGAATCCAAGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)