EMAIL THIS PAGE TO A FRIEND

LIN9

lin-9 homolog (C. elegans)

129 Gene Product Result for
Synonyms: BARA BARPsv Lin-9 TGS TGS1 TGS2
UniProtKB ID: Q5TKA1, Q5U5L8, Q5U7E1, Q6PI55, Q6ZTV4, Q7Z3J1
Gene ID:
Human(286826) Summary: This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(72568) lin-9 homolog (C. elegans)
Rat(689523) lin-9 homolog (C. elegans)
Zebrafish(560867) lin-9 homolog (C. elegans)
chicken(421316) lin-9 homolog (C. elegans)
cow(534587) lin-9 homolog (C. elegans)
domestic cat(101087036) lin-9 homolog (C. elegans)
dog(611881) lin-9 homolog (C. elegans)
domestic guinea pig(100734204) lin-9 homolog (C. elegans)
naked mole-rat(101701448) lin-9 homolog (C. elegans)
sheep(101112835) lin-9 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173083 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173083 Rosetta Predictions human pricing
XM_001067807 Rosetta Predictions rat pricing
NM_001103182 Rosetta Predictions mouse pricing
NM_175186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074343 predicted 898
2 SASI_Hs01_00074345 predicted 704
3 SASI_Hs01_00074346 predicted 1018
4 SASI_Hs02_00368082 predicted 719
5 SASI_Hs01_00074347 predicted 1194
6 SASI_Hs01_00074348 predicted 1801
7 SASI_Hs01_00074349 predicted 587
8 SASI_Hs01_00074350 predicted 1893
9 SASI_Hs02_00368083 predicted 773
10 SASI_Hs01_00074352 predicted 638
11 SASI_Hs01_00074344 predicted 1823
12 SASI_Hs01_00074351 predicted 1989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322397 predicted 838
2 SASI_Rn02_00322398 predicted 1160
3 SASI_Rn02_00322399 predicted 777
4 SASI_Rn02_00322400 predicted 704
5 SASI_Rn02_00322401 predicted 1043
6 SASI_Rn02_00322402 predicted 1368
7 SASI_Rn02_00322403 predicted 1541
8 SASI_Rn02_00322404 predicted 1062
9 SASI_Rn02_00322405 predicted 1043
10 SASI_Rn02_00322406 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303214 predicted 408
2 SASI_Mm02_00303215 predicted 382
3 SASI_Mm02_00303216 predicted 574
4 SASI_Mm02_00303217 predicted 821
5 SASI_Mm02_00303218 predicted 283
6 SASI_Mm02_00303219 predicted 684
7 SASI_Mm02_00303220 predicted 230
8 SASI_Mm02_00303221 predicted 473
9 SASI_Mm02_00303222 predicted 744
10 SASI_Mm02_00303223 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070132 predicted 406
2 SASI_Mm01_00070133 predicted 378
3 SASI_Mm01_00070134 predicted 579
4 SASI_Mm01_00070135 predicted 818
5 SASI_Mm01_00070138 predicted 274
6 SASI_Mm01_00070139 predicted 689
7 SASI_Mm01_00070140 predicted 226
8 SASI_Mm02_00345846 predicted 468
9 SASI_Mm01_00070141 predicted 747
10 SASI_Mm02_00345847 predicted 226
11 SASI_Mm01_00070136 predicted 456
12 SASI_Mm01_00070137 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175186
VALIDATED
LIN9 MISSION shRNA Bacterial Glycerol Stock
lin-9 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-1274s21c1
Sequence:CCGGATGAGGTGAGTGGCGTATATTCTCGAGAATATACGCCACTCACCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1065s21c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-962s21c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1175s21c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-551s21c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1047s1c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1157s1c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-533s1c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-944s1c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-450s1c1
Sequence:CCGGCCTAAAGGAATCCTTTCCTAACTCGAGTTAGGAAAGGATTCCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175186
VALIDATED
LIN9 MISSION shRNA shRNA Plasmid DNA
lin-9 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-1274s21c1
Sequence:CCGGATGAGGTGAGTGGCGTATATTCTCGAGAATATACGCCACTCACCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1065s21c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-962s21c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1175s21c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-551s21c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1047s1c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1157s1c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-533s1c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-944s1c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-450s1c1
Sequence:CCGGCCTAAAGGAATCCTTTCCTAACTCGAGTTAGGAAAGGATTCCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175186
VALIDATED
LIN9 MISSION shRNA Lentiviral Transduction Particles
lin-9 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-1274s21c1
Sequence:CCGGATGAGGTGAGTGGCGTATATTCTCGAGAATATACGCCACTCACCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1065s21c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175186.4-962s21c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-1175s21c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175186.4-551s21c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1047s1c1
Sequence:CCGGCCAGGTGACTAAGTTATCAAACTCGAGTTTGATAACTTAGTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-1157s1c1
Sequence:CCGGGCATTGAGTTTCAGCGGAGATCTCGAGATCTCCGCTGAAACTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-533s1c1
Sequence:CCGGCTCGGAGATGTTCTTCTGCATCTCGAGATGCAGAAGAACATCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-944s1c1
Sequence:CCGGCAATTACAGATGGCGATCCTTCTCGAGAAGGATCGCCATCTGTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175186.2-450s1c1
Sequence:CCGGCCTAAAGGAATCCTTTCCTAACTCGAGTTAGGAAAGGATTCCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173083
VALIDATED
LIN9 MISSION shRNA Bacterial Glycerol Stock
lin-9 homolog (C. elegans)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173083.2-2562s21c1
Sequence:CCGGACATGGTTCTGTAGATCATTTCTCGAGAAATGATCTACAGAACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1511s21c1
Sequence:CCGGCAGCGGAGATATGCAACAATTCTCGAGAATTGTTGCATATCTCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173083.2-1387s21c1
Sequence:CCGGTATCCAAGTGACCAGATTATCCTCGAGGATAATCTGGTCACTTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1096s21c1
Sequence:CCGGTACTCTTAATGCTACTTATAGCTCGAGCTATAAGTAGCATTAAGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1028s21c1
Sequence:CCGGACGAAAGTTACAGCACGATTACTCGAGTAATCGTGCTGTAACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173083.2-1500s1c1
Sequence:CCGGGCATTGAATTTCAGCGGAGATCTCGAGATCTCCGCTGAAATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-476s1c1
Sequence:CCGGCCTGTTTGGAAAGGCAGGAATCTCGAGATTCCTGCCTTTCCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-2499s1c1
Sequence:CCGGCCACTGAAATATAGATGGGAACTCGAGTTCCCATCTATATTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-1868s1c1
Sequence:CCGGGCTTCTAATATCAGTTGCTTTCTCGAGAAAGCAACTGATATTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-1279s1c1
Sequence:CCGGCCAGTCACCAATTATAGATAACTCGAGTTATCTATAATTGGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_173083.2-1867s1c1
Sequence:CCGGCGCTTCTAATATCAGTTGCTTCTCGAGAAGCAACTGATATTAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173083
VALIDATED
LIN9 MISSION shRNA shRNA Plasmid DNA
lin-9 homolog (C. elegans)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173083.2-2562s21c1
Sequence:CCGGACATGGTTCTGTAGATCATTTCTCGAGAAATGATCTACAGAACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1511s21c1
Sequence:CCGGCAGCGGAGATATGCAACAATTCTCGAGAATTGTTGCATATCTCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173083.2-1387s21c1
Sequence:CCGGTATCCAAGTGACCAGATTATCCTCGAGGATAATCTGGTCACTTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1096s21c1
Sequence:CCGGTACTCTTAATGCTACTTATAGCTCGAGCTATAAGTAGCATTAAGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1028s21c1
Sequence:CCGGACGAAAGTTACAGCACGATTACTCGAGTAATCGTGCTGTAACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173083.2-1500s1c1
Sequence:CCGGGCATTGAATTTCAGCGGAGATCTCGAGATCTCCGCTGAAATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-476s1c1
Sequence:CCGGCCTGTTTGGAAAGGCAGGAATCTCGAGATTCCTGCCTTTCCAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-2499s1c1
Sequence:CCGGCCACTGAAATATAGATGGGAACTCGAGTTCCCATCTATATTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-1868s1c1
Sequence:CCGGGCTTCTAATATCAGTTGCTTTCTCGAGAAAGCAACTGATATTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-1279s1c1
Sequence:CCGGCCAGTCACCAATTATAGATAACTCGAGTTATCTATAATTGGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_173083.2-1867s1c1
Sequence:CCGGCGCTTCTAATATCAGTTGCTTCTCGAGAAGCAACTGATATTAGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173083
VALIDATED
LIN9 MISSION shRNA Lentiviral Transduction Particles
lin-9 homolog (C. elegans)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173083.2-2562s21c1
Sequence:CCGGACATGGTTCTGTAGATCATTTCTCGAGAAATGATCTACAGAACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1511s21c1
Sequence:CCGGCAGCGGAGATATGCAACAATTCTCGAGAATTGTTGCATATCTCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173083.2-1387s21c1
Sequence:CCGGTATCCAAGTGACCAGATTATCCTCGAGGATAATCTGGTCACTTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1096s21c1
Sequence:CCGGTACTCTTAATGCTACTTATAGCTCGAGCTATAAGTAGCATTAAGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173083.2-1028s21c1
Sequence:CCGGACGAAAGTTACAGCACGATTACTCGAGTAATCGTGCTGTAACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173083.2-1500s1c1
Sequence:CCGGGCATTGAATTTCAGCGGAGATCTCGAGATCTCCGCTGAAATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-476s1c1
Sequence:CCGGCCTGTTTGGAAAGGCAGGAATCTCGAGATTCCTGCCTTTCCAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-2499s1c1
Sequence:CCGGCCACTGAAATATAGATGGGAACTCGAGTTCCCATCTATATTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173083.2-1868s1c1
Sequence:CCGGGCTTCTAATATCAGTTGCTTTCTCGAGAAAGCAACTGATATTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173083.2-1279s1c1
Sequence:CCGGCCAGTCACCAATTATAGATAACTCGAGTTATCTATAATTGGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_173083.2-1867s1c1
Sequence:CCGGCGCTTCTAATATCAGTTGCTTCTCGAGAAGCAACTGATATTAGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)