EMAIL THIS PAGE TO A FRIEND

LINC00083

long intergenic non-protein coding RNA 83

41 Gene Product Result for
Synonyms: NCRNA00083
Species: Human LINC00083(400797)
UniProtKB ID: Q6ZU45
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001689 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_378918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378918 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138611 MISSION® esiRNA esiRNA human NCRNA00083 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001689 Rosetta Predictions human pricing
XR_040317 Rosetta Predictions human pricing
XR_040318 Rosetta Predictions human pricing
XR_040319 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168550 predicted 2017
2 SASI_Hs01_00168551 predicted 2170
3 SASI_Hs01_00168552 predicted 2031
4 SASI_Hs01_00168553 predicted 2113
5 SASI_Hs01_00168554 predicted 2175
6 SASI_Hs01_00168555 predicted 2191
7 SASI_Hs01_00168556 predicted 2167
8 SASI_Hs01_00168557 predicted 1884
9 SASI_Hs01_00168558 predicted 1940
10 SASI_Hs01_00168559 predicted 2137
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517784 predicted 245
2 SASI_Hs02_00517785 predicted 402
3 SASI_Hs02_00517786 predicted 256
4 SASI_Hs02_00517787 predicted 338
5 SASI_Hs02_00517788 predicted 400
6 SASI_Hs02_00517789 predicted 400
7 SASI_Hs02_00517790 predicted 360
8 SASI_Hs02_00517791 predicted 314
9 SASI_Hs02_00517792 predicted 406
10 SASI_Hs02_00517793 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517794 predicted 238
2 SASI_Hs02_00517795 predicted 401
3 SASI_Hs02_00517796 predicted 255
4 SASI_Hs02_00517797 predicted 342
5 SASI_Hs02_00517798 predicted 396
6 SASI_Hs02_00517799 predicted 401
7 SASI_Hs02_00517800 predicted 358
8 SASI_Hs02_00517801 predicted 319
9 SASI_Hs02_00517802 predicted 405
10 SASI_Hs02_00517803 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517804 predicted 239
2 SASI_Hs02_00517805 predicted 405
3 SASI_Hs02_00517806 predicted 255
4 SASI_Hs02_00517807 predicted 337
5 SASI_Hs02_00517808 predicted 395
6 SASI_Hs02_00517809 predicted 395
7 SASI_Hs02_00517810 predicted 357
8 SASI_Hs02_00517811 predicted 315
9 SASI_Hs02_00517812 predicted 410
10 SASI_Hs02_00517813 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001689
LINC00083 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 83
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-2365s1c1
Sequence:CCGGCTACTGTGGTGTGTTCACATTCTCGAGAATGTGAACACACCACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-1947s1c1
Sequence:CCGGCTGAAAGCTCTTTGAGGACTACTCGAGTAGTCCTCAAAGAGCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2767s1c1
Sequence:CCGGGCACCCTTTCAGAGGATAACTCTCGAGAGTTATCCTCTGAAAGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001689.1-2256s1c1
Sequence:CCGGGCCAGAAGCTACCTGAATTTGCTCGAGCAAATTCAGGTAGCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2629s1c1
Sequence:CCGGGTCTCAAATTCTTGCCTTCAACTCGAGTTGAAGGCAAGAATTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001689
LINC00083 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 83
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-2365s1c1
Sequence:CCGGCTACTGTGGTGTGTTCACATTCTCGAGAATGTGAACACACCACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-1947s1c1
Sequence:CCGGCTGAAAGCTCTTTGAGGACTACTCGAGTAGTCCTCAAAGAGCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2767s1c1
Sequence:CCGGGCACCCTTTCAGAGGATAACTCTCGAGAGTTATCCTCTGAAAGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001689.1-2256s1c1
Sequence:CCGGGCCAGAAGCTACCTGAATTTGCTCGAGCAAATTCAGGTAGCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2629s1c1
Sequence:CCGGGTCTCAAATTCTTGCCTTCAACTCGAGTTGAAGGCAAGAATTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001689
LINC00083 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 83
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-2365s1c1
Sequence:CCGGCTACTGTGGTGTGTTCACATTCTCGAGAATGTGAACACACCACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001689.1-1947s1c1
Sequence:CCGGCTGAAAGCTCTTTGAGGACTACTCGAGTAGTCCTCAAAGAGCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2767s1c1
Sequence:CCGGGCACCCTTTCAGAGGATAACTCTCGAGAGTTATCCTCTGAAAGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001689.1-2256s1c1
Sequence:CCGGGCCAGAAGCTACCTGAATTTGCTCGAGCAAATTCAGGTAGCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001689.1-2629s1c1
Sequence:CCGGGTCTCAAATTCTTGCCTTCAACTCGAGTTGAAGGCAAGAATTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378918
LINC00083 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 83
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378918.1-1639s1c1
Sequence:CCGGGCAAGCATTGTCTATTGTTATCTCGAGATAACAATAGACAATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378918
LINC00083 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 83
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378918.1-1639s1c1
Sequence:CCGGGCAAGCATTGTCTATTGTTATCTCGAGATAACAATAGACAATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378918
LINC00083 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 83
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378918.1-1639s1c1
Sequence:CCGGGCAAGCATTGTCTATTGTTATCTCGAGATAACAATAGACAATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)