EMAIL THIS PAGE TO A FRIEND

LINC00114

long intergenic non-protein coding RNA 114

41 Gene Product Result for
Synonyms: C21orf24 NCRNA00114
Species: Human LINC00114(400866)
UniProtKB ID: Q6XXX2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103282 Anti-NCRNA00114, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001789 Rosetta Predictions human pricing
XR_041644 Rosetta Predictions human pricing
XR_041645 Rosetta Predictions human pricing
XR_041646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197847 predicted 510
2 SASI_Hs01_00197848 predicted 351
3 SASI_Hs01_00197849 predicted 392
4 SASI_Hs01_00197850 predicted 418
5 SASI_Hs01_00197851 predicted 347
6 SASI_Hs01_00197852 predicted 344
7 SASI_Hs01_00197853 predicted 386
8 SASI_Hs01_00197854 predicted 443
9 SASI_Hs01_00197855 predicted 380
10 SASI_Hs01_00197856 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529159 predicted 198
2 SASI_Hs02_00529160 predicted 171
3 SASI_Hs02_00529161 predicted 11
4 SASI_Hs02_00529162 predicted 54
5 SASI_Hs02_00529163 predicted 339
6 SASI_Hs02_00529164 predicted 83
7 SASI_Hs02_00529165 predicted 11
8 SASI_Hs02_00529166 predicted 7
9 SASI_Hs02_00529167 predicted 50
10 SASI_Hs02_00529168 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529169 predicted 195
2 SASI_Hs02_00529170 predicted 175
3 SASI_Hs02_00529171 predicted 15
4 SASI_Hs02_00529172 predicted 49
5 SASI_Hs02_00529173 predicted 340
6 SASI_Hs02_00529174 predicted 89
7 SASI_Hs02_00529175 predicted 9
8 SASI_Hs02_00529176 predicted 8
9 SASI_Hs02_00529177 predicted 46
10 SASI_Hs02_00529178 predicted 111
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529179 predicted 195
2 SASI_Hs02_00529180 predicted 175
3 SASI_Hs02_00529181 predicted 13
4 SASI_Hs02_00529182 predicted 52
5 SASI_Hs02_00529183 predicted 343
6 SASI_Hs02_00529184 predicted 90
7 SASI_Hs02_00529185 predicted 6
8 SASI_Hs02_00529186 predicted 7
9 SASI_Hs02_00529187 predicted 51
10 SASI_Hs02_00529188 predicted 111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001789
LINC00114 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 114
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-3196s1c1
Sequence:CCGGGCCTATGTCAAGTCACACATTCTCGAGAATGTGTGACTTGACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-398s1c1
Sequence:CCGGCAAAGATGAGAACTGGATGGACTCGAGTCCATCCAGTTCTCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-388s1c1
Sequence:CCGGGAATCGTTCTCAAAGATGAGACTCGAGTCTCATCTTTGAGAACGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-384s1c1
Sequence:CCGGCCAAGAATCGTTCTCAAAGATCTCGAGATCTTTGAGAACGATTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2090s1c1
Sequence:CCGGCCTCAAATTCTTGGACTCAATCTCGAGATTGAGTCCAAGAATTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-375s1c1
Sequence:CCGGGCTTTCATCCCAAGAATCGTTCTCGAGAACGATTCTTGGGATGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-580s1c1
Sequence:CCGGCCTTCAAAGTGCTCATGTCCACTCGAGTGGACATGAGCACTTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2089s1c1
Sequence:CCGGGCCTCAAATTCTTGGACTCAACTCGAGTTGAGTCCAAGAATTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001789
LINC00114 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 114
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-3196s1c1
Sequence:CCGGGCCTATGTCAAGTCACACATTCTCGAGAATGTGTGACTTGACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-398s1c1
Sequence:CCGGCAAAGATGAGAACTGGATGGACTCGAGTCCATCCAGTTCTCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-388s1c1
Sequence:CCGGGAATCGTTCTCAAAGATGAGACTCGAGTCTCATCTTTGAGAACGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-384s1c1
Sequence:CCGGCCAAGAATCGTTCTCAAAGATCTCGAGATCTTTGAGAACGATTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2090s1c1
Sequence:CCGGCCTCAAATTCTTGGACTCAATCTCGAGATTGAGTCCAAGAATTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-375s1c1
Sequence:CCGGGCTTTCATCCCAAGAATCGTTCTCGAGAACGATTCTTGGGATGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-580s1c1
Sequence:CCGGCCTTCAAAGTGCTCATGTCCACTCGAGTGGACATGAGCACTTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2089s1c1
Sequence:CCGGGCCTCAAATTCTTGGACTCAACTCGAGTTGAGTCCAAGAATTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001789
LINC00114 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 114
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-3196s1c1
Sequence:CCGGGCCTATGTCAAGTCACACATTCTCGAGAATGTGTGACTTGACATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-398s1c1
Sequence:CCGGCAAAGATGAGAACTGGATGGACTCGAGTCCATCCAGTTCTCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-388s1c1
Sequence:CCGGGAATCGTTCTCAAAGATGAGACTCGAGTCTCATCTTTGAGAACGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-384s1c1
Sequence:CCGGCCAAGAATCGTTCTCAAAGATCTCGAGATCTTTGAGAACGATTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2090s1c1
Sequence:CCGGCCTCAAATTCTTGGACTCAATCTCGAGATTGAGTCCAAGAATTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-375s1c1
Sequence:CCGGGCTTTCATCCCAAGAATCGTTCTCGAGAACGATTCTTGGGATGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001789.1-580s1c1
Sequence:CCGGCCTTCAAAGTGCTCATGTCCACTCGAGTGGACATGAGCACTTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001789.1-2089s1c1
Sequence:CCGGGCCTCAAATTCTTGGACTCAACTCGAGTTGAGTCCAAGAATTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)