EMAIL THIS PAGE TO A FRIEND

LINC00115

long intergenic non-protein coding RNA 115

32 Gene Product Result for
Synonyms: NCRNA00115
Species: Human LINC00115(79854)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024796 Rosetta Predictions human pricing
XR_017693 Rosetta Predictions human pricing
XR_040152 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194903 predicted 849
2 SASI_Hs01_00194904 predicted 720
3 SASI_Hs01_00194905 predicted 1074
4 SASI_Hs01_00194906 predicted 984
5 SASI_Hs01_00194907 predicted 876
6 SASI_Hs01_00194908 predicted 921
7 SASI_Hs01_00194909 predicted 772
8 SASI_Hs01_00194910 predicted 566
9 SASI_Hs01_00194911 predicted 884
10 SASI_Hs01_00194912 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494004 predicted 865
2 SASI_Hs02_00494005 predicted 1100
3 SASI_Hs02_00494006 predicted 743
4 SASI_Hs02_00494007 predicted 998
5 SASI_Hs02_00494008 predicted 890
6 SASI_Hs02_00494009 predicted 270
7 SASI_Hs02_00494010 predicted 326
8 SASI_Hs02_00494011 predicted 774
9 SASI_Hs02_00494012 predicted 589
10 SASI_Hs02_00494013 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516378 predicted 860
2 SASI_Hs02_00516379 predicted 745
3 SASI_Hs02_00516380 predicted 1098
4 SASI_Hs02_00516381 predicted 1007
5 SASI_Hs02_00516382 predicted 897
6 SASI_Hs02_00516383 predicted 326
7 SASI_Hs02_00516384 predicted 935
8 SASI_Hs02_00516385 predicted 769
9 SASI_Hs02_00516386 predicted 583
10 SASI_Hs02_00516387 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024796
LINC00115 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 115
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-726s1c1
Sequence:CCGGGAAGTTTAGATGGGAAGTGGACTCGAGTCCACTTCCCATCTAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-980s1c1
Sequence:CCGGGTTCAGCTTATGAGGCCTCAACTCGAGTTGAGGCCTCATAAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-763s1c1
Sequence:CCGGGAACAAACACCGACAGTGAAGCTCGAGCTTCACTGTCGGTGTTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-595s1c1
Sequence:CCGGCCCACTGAGAAGCGGGCTCTTCTCGAGAAGAGCCCGCTTCTCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-516s1c1
Sequence:CCGGCGATCCTGTAACAACCCTCGTCTCGAGACGAGGGTTGTTACAGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-908s1c1
Sequence:CCGGGCCTAATTCCCAAATTCCTTACTCGAGTAAGGAATTTGGGAATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-757s1c1
Sequence:CCGGGAATTTGAACAAACACCGACACTCGAGTGTCGGTGTTTGTTCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-846s1c1
Sequence:CCGGGATATGGAGGACAGAATACAACTCGAGTTGTATTCTGTCCTCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1109s1c1
Sequence:CCGGGTATTCAACAGCTTCCTCTATCTCGAGATAGAGGAAGCTGTTGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1117s1c1
Sequence:CCGGCAGCTTCCTCTATTCCTTTATCTCGAGATAAAGGAATAGAGGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024796
LINC00115 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 115
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-726s1c1
Sequence:CCGGGAAGTTTAGATGGGAAGTGGACTCGAGTCCACTTCCCATCTAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-980s1c1
Sequence:CCGGGTTCAGCTTATGAGGCCTCAACTCGAGTTGAGGCCTCATAAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-763s1c1
Sequence:CCGGGAACAAACACCGACAGTGAAGCTCGAGCTTCACTGTCGGTGTTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-595s1c1
Sequence:CCGGCCCACTGAGAAGCGGGCTCTTCTCGAGAAGAGCCCGCTTCTCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-516s1c1
Sequence:CCGGCGATCCTGTAACAACCCTCGTCTCGAGACGAGGGTTGTTACAGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-908s1c1
Sequence:CCGGGCCTAATTCCCAAATTCCTTACTCGAGTAAGGAATTTGGGAATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-757s1c1
Sequence:CCGGGAATTTGAACAAACACCGACACTCGAGTGTCGGTGTTTGTTCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-846s1c1
Sequence:CCGGGATATGGAGGACAGAATACAACTCGAGTTGTATTCTGTCCTCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1109s1c1
Sequence:CCGGGTATTCAACAGCTTCCTCTATCTCGAGATAGAGGAAGCTGTTGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1117s1c1
Sequence:CCGGCAGCTTCCTCTATTCCTTTATCTCGAGATAAAGGAATAGAGGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024796
LINC00115 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 115
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-726s1c1
Sequence:CCGGGAAGTTTAGATGGGAAGTGGACTCGAGTCCACTTCCCATCTAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-980s1c1
Sequence:CCGGGTTCAGCTTATGAGGCCTCAACTCGAGTTGAGGCCTCATAAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024796.1-763s1c1
Sequence:CCGGGAACAAACACCGACAGTGAAGCTCGAGCTTCACTGTCGGTGTTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-595s1c1
Sequence:CCGGCCCACTGAGAAGCGGGCTCTTCTCGAGAAGAGCCCGCTTCTCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-516s1c1
Sequence:CCGGCGATCCTGTAACAACCCTCGTCTCGAGACGAGGGTTGTTACAGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-908s1c1
Sequence:CCGGGCCTAATTCCCAAATTCCTTACTCGAGTAAGGAATTTGGGAATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024796.1-757s1c1
Sequence:CCGGGAATTTGAACAAACACCGACACTCGAGTGTCGGTGTTTGTTCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024796.1-846s1c1
Sequence:CCGGGATATGGAGGACAGAATACAACTCGAGTTGTATTCTGTCCTCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1109s1c1
Sequence:CCGGGTATTCAACAGCTTCCTCTATCTCGAGATAGAGGAAGCTGTTGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024796.1-1117s1c1
Sequence:CCGGCAGCTTCCTCTATTCCTTTATCTCGAGATAAAGGAATAGAGGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)