EMAIL THIS PAGE TO A FRIEND

LINC00152

long intergenic non-protein coding RNA 152

83 Gene Product Result for
Synonyms: C2orf59 NCRNA00152
Species: Human LINC00152(112597)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052871 Rosetta Predictions human pricing
XR_042051 Rosetta Predictions human pricing
XR_042052 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018174 predicted 444
2 SASI_Hs01_00018175 predicted 412
3 SASI_Hs01_00018176 predicted 406
4 SASI_Hs01_00018177 predicted 298
5 SASI_Hs01_00018178 predicted 349
6 SASI_Hs01_00018179 predicted 436
7 SASI_Hs01_00018180 predicted 295
8 SASI_Hs01_00018181 predicted 346
9 SASI_Hs01_00018182 predicted 276
10 SASI_Hs01_00018183 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532647 predicted 204
2 SASI_Hs02_00532648 predicted 168
3 SASI_Hs02_00532649 predicted 168
4 SASI_Hs02_00532650 predicted 57
5 SASI_Hs02_00532651 predicted 111
6 SASI_Hs02_00532652 predicted 201
7 SASI_Hs02_00532653 predicted 67
8 SASI_Hs02_00532654 predicted 107
9 SASI_Hs02_00532655 predicted 38
10 SASI_Hs02_00532656 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532657 predicted 136
2 SASI_Hs02_00532658 predicted 165
3 SASI_Hs02_00532659 predicted 60
4 SASI_Hs02_00532660 predicted 115
5 SASI_Hs02_00532661 predicted 99
6 SASI_Hs02_00532662 predicted 139
7 SASI_Hs02_00532663 predicted 46
8 SASI_Hs02_00532664 predicted 158
9 SASI_Hs02_00532665 predicted 55
10 SASI_Hs02_00532666 predicted 134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052871
LINC00152 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 152
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1399s1c1
Sequence:CCGGCACAGCCGGAATGCAGCTGAACTCGAGTTCAGCTGCATTCCGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1448s1c1
Sequence:CCGGCCACTGTGGACTCTGAGGCCTCTCGAGAGGCCTCAGAGTCCACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052871
LINC00152 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 152
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1399s1c1
Sequence:CCGGCACAGCCGGAATGCAGCTGAACTCGAGTTCAGCTGCATTCCGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1448s1c1
Sequence:CCGGCCACTGTGGACTCTGAGGCCTCTCGAGAGGCCTCAGAGTCCACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052871
LINC00152 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 152
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1399s1c1
Sequence:CCGGCACAGCCGGAATGCAGCTGAACTCGAGTTCAGCTGCATTCCGGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052871.1-1448s1c1
Sequence:CCGGCCACTGTGGACTCTGAGGCCTCTCGAGAGGCCTCAGAGTCCACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)