EMAIL THIS PAGE TO A FRIEND

LINC00158

long intergenic non-protein coding RNA 158

2 Gene Product Result for
Synonyms: C21orf42 NCRNA00158
Species: Human LINC00158(54072)
UniProtKB ID: P58513
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058184
LINC00158 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 158
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-550s1c1
Sequence:CCGGGATCAGATTTGGAAGTGACCACTCGAGTGGTCACTTCCAAATCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-542s1c1
Sequence:CCGGCATGTGCAGATCAGATTTGGACTCGAGTCCAAATCTGATCTGCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-497s1c1
Sequence:CCGGGATGAGCACAGATCACATCAACTCGAGTTGATGTGATCTGTGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-438s1c1
Sequence:CCGGCCTTAGTAACAGATGTCAGTACTCGAGTACTGACATCTGTTACTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058184.1-725s1c1
Sequence:CCGGGAATGTGAAGAGGAGATGAATCTCGAGATTCATCTCCTCTTCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-480s1c1
Sequence:CCGGCTTTACCAAGGATTAAGGATGCTCGAGCATCCTTAATCCTTGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-505s1c1
Sequence:CCGGCAGATCACATCAAGAGTCTAACTCGAGTTAGACTCTTGATGTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-548s1c1
Sequence:CCGGCAGATCAGATTTGGAAGTGACCTCGAGGTCACTTCCAAATCTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058184
LINC00158 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 158
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-550s1c1
Sequence:CCGGGATCAGATTTGGAAGTGACCACTCGAGTGGTCACTTCCAAATCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-542s1c1
Sequence:CCGGCATGTGCAGATCAGATTTGGACTCGAGTCCAAATCTGATCTGCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-497s1c1
Sequence:CCGGGATGAGCACAGATCACATCAACTCGAGTTGATGTGATCTGTGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-438s1c1
Sequence:CCGGCCTTAGTAACAGATGTCAGTACTCGAGTACTGACATCTGTTACTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058184.1-725s1c1
Sequence:CCGGGAATGTGAAGAGGAGATGAATCTCGAGATTCATCTCCTCTTCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-480s1c1
Sequence:CCGGCTTTACCAAGGATTAAGGATGCTCGAGCATCCTTAATCCTTGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-505s1c1
Sequence:CCGGCAGATCACATCAAGAGTCTAACTCGAGTTAGACTCTTGATGTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-548s1c1
Sequence:CCGGCAGATCAGATTTGGAAGTGACCTCGAGGTCACTTCCAAATCTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058184
LINC00158 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 158
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-550s1c1
Sequence:CCGGGATCAGATTTGGAAGTGACCACTCGAGTGGTCACTTCCAAATCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-542s1c1
Sequence:CCGGCATGTGCAGATCAGATTTGGACTCGAGTCCAAATCTGATCTGCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-497s1c1
Sequence:CCGGGATGAGCACAGATCACATCAACTCGAGTTGATGTGATCTGTGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-438s1c1
Sequence:CCGGCCTTAGTAACAGATGTCAGTACTCGAGTACTGACATCTGTTACTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058184.1-725s1c1
Sequence:CCGGGAATGTGAAGAGGAGATGAATCTCGAGATTCATCTCCTCTTCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-480s1c1
Sequence:CCGGCTTTACCAAGGATTAAGGATGCTCGAGCATCCTTAATCCTTGGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-505s1c1
Sequence:CCGGCAGATCACATCAAGAGTCTAACTCGAGTTAGACTCTTGATGTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058184.1-548s1c1
Sequence:CCGGCAGATCAGATTTGGAAGTGACCTCGAGGTCACTTCCAAATCTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)