EMAIL THIS PAGE TO A FRIEND

LINC00167

long intergenic non-protein coding RNA 167

42 Gene Product Result for
Synonyms: C11orf37 NCRNA00167
Species: Human LINC00167(440072)
UniProtKB ID: Q96N53, B2RP80
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007543 Rosetta Predictions human pricing
XR_040639 Rosetta Predictions human pricing
XR_040640 Rosetta Predictions human pricing
XR_040641 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149257 predicted 951
2 SASI_Hs01_00149258 predicted 987
3 SASI_Hs01_00149259 predicted 515
4 SASI_Hs01_00149260 predicted 937
5 SASI_Hs01_00149261 predicted 958
6 SASI_Hs01_00149262 predicted 981
7 SASI_Hs01_00149263 predicted 933
8 SASI_Hs01_00149264 predicted 878
9 SASI_Hs01_00149265 predicted 943
10 SASI_Hs01_00149266 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520647 predicted 499
2 SASI_Hs02_00520648 predicted 491
3 SASI_Hs02_00520649 predicted 631
4 SASI_Hs02_00520650 predicted 423
5 SASI_Hs02_00520651 predicted 564
6 SASI_Hs02_00520652 predicted 440
7 SASI_Hs02_00520653 predicted 409
8 SASI_Hs02_00520654 predicted 445
9 SASI_Hs02_00520655 predicted 496
10 SASI_Hs02_00520656 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520657 predicted 625
2 SASI_Hs02_00520658 predicted 492
3 SASI_Hs02_00520659 predicted 426
4 SASI_Hs02_00520660 predicted 492
5 SASI_Hs02_00520661 predicted 559
6 SASI_Hs02_00520662 predicted 432
7 SASI_Hs02_00520663 predicted 408
8 SASI_Hs02_00520664 predicted 451
9 SASI_Hs02_00520665 predicted 634
10 SASI_Hs02_00520666 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520667 predicted 495
2 SASI_Hs02_00520668 predicted 498
3 SASI_Hs02_00520669 predicted 625
4 SASI_Hs02_00520670 predicted 426
5 SASI_Hs02_00520671 predicted 564
6 SASI_Hs02_00520672 predicted 435
7 SASI_Hs02_00520673 predicted 410
8 SASI_Hs02_00520674 predicted 444
9 SASI_Hs02_00520675 predicted 491
10 SASI_Hs02_00520676 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007543
LINC00167 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 167
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1260s1c1
Sequence:CCGGCCGAGTAAAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTTTACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1334s1c1
Sequence:CCGGCCTAAACTATTGCCTGAGAAACTCGAGTTTCTCAGGCAATAGTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2010s1c1
Sequence:CCGGGCTTTGTAAACAACTTCACATCTCGAGATGTGAAGTTGTTTACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1682s1c1
Sequence:CCGGCGAACTCTAACGTCAAGTGATCTCGAGATCACTTGACGTTAGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1281s1c1
Sequence:CCGGGCACACTGTCTGGAACTTAAACTCGAGTTTAAGTTCCAGACAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2035s1c1
Sequence:CCGGGCCGTGTCTTGTTCTTCCTTACTCGAGTAAGGAAGAACAAGACACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2037s1c1
Sequence:CCGGCGTGTCTTGTTCTTCCTTAAACTCGAGTTTAAGGAAGAACAAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1183s1c1
Sequence:CCGGCGGTGATATCTACCTTGCTATCTCGAGATAGCAAGGTAGATATCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007543
LINC00167 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 167
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1260s1c1
Sequence:CCGGCCGAGTAAAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTTTACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1334s1c1
Sequence:CCGGCCTAAACTATTGCCTGAGAAACTCGAGTTTCTCAGGCAATAGTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2010s1c1
Sequence:CCGGGCTTTGTAAACAACTTCACATCTCGAGATGTGAAGTTGTTTACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1682s1c1
Sequence:CCGGCGAACTCTAACGTCAAGTGATCTCGAGATCACTTGACGTTAGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1281s1c1
Sequence:CCGGGCACACTGTCTGGAACTTAAACTCGAGTTTAAGTTCCAGACAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2035s1c1
Sequence:CCGGGCCGTGTCTTGTTCTTCCTTACTCGAGTAAGGAAGAACAAGACACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2037s1c1
Sequence:CCGGCGTGTCTTGTTCTTCCTTAAACTCGAGTTTAAGGAAGAACAAGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1183s1c1
Sequence:CCGGCGGTGATATCTACCTTGCTATCTCGAGATAGCAAGGTAGATATCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007543
LINC00167 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 167
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1260s1c1
Sequence:CCGGCCGAGTAAAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTTTACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1334s1c1
Sequence:CCGGCCTAAACTATTGCCTGAGAAACTCGAGTTTCTCAGGCAATAGTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2010s1c1
Sequence:CCGGGCTTTGTAAACAACTTCACATCTCGAGATGTGAAGTTGTTTACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1682s1c1
Sequence:CCGGCGAACTCTAACGTCAAGTGATCTCGAGATCACTTGACGTTAGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1281s1c1
Sequence:CCGGGCACACTGTCTGGAACTTAAACTCGAGTTTAAGTTCCAGACAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2035s1c1
Sequence:CCGGGCCGTGTCTTGTTCTTCCTTACTCGAGTAAGGAAGAACAAGACACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-2037s1c1
Sequence:CCGGCGTGTCTTGTTCTTCCTTAAACTCGAGTTTAAGGAAGAACAAGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007543.1-1183s1c1
Sequence:CCGGCGGTGATATCTACCTTGCTATCTCGAGATAGCAAGGTAGATATCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)