EMAIL THIS PAGE TO A FRIEND

LINC00174

long intergenic non-protein coding RNA 174

14 Gene Product Result for
Synonyms: NCRNA00174
Species: Human LINC00174(285908)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104944 Anti-LOC285908 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181722 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105545 predicted 2980
2 SASI_Hs01_00105546 predicted 2910
3 SASI_Hs01_00105547 predicted 3363
4 SASI_Hs01_00105548 predicted 3227
5 SASI_Hs01_00105549 predicted 2909
6 SASI_Hs01_00105550 predicted 3988
7 SASI_Hs01_00105551 predicted 2865
8 SASI_Hs01_00105552 predicted 3996
9 SASI_Hs01_00105553 predicted 4362
10 SASI_Hs01_00105554 predicted 4370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181722
LINC00174 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 174
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181722.2-4222s21c1
Sequence:CCGGGTATTCCCTTCTTCGGGATACCTCGAGGTATCCCGAAGAAGGGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3129s21c1
Sequence:CCGGTGCCTCACGACAACCACGTTCCTCGAGGAACGTGGTTGTCGTGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2885s21c1
Sequence:CCGGTGAAATAAGCCTCGCCAGGAACTCGAGTTCCTGGCGAGGCTTATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3460s21c1
Sequence:CCGGTGCGTCCCGAAGGCTTCTCTACTCGAGTAGAGAAGCCTTCGGGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2918s21c1
Sequence:CCGGTGGATGCCCGAACAACCATAGCTCGAGCTATGGTTGTTCGGGCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181722
LINC00174 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 174
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181722.2-4222s21c1
Sequence:CCGGGTATTCCCTTCTTCGGGATACCTCGAGGTATCCCGAAGAAGGGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3129s21c1
Sequence:CCGGTGCCTCACGACAACCACGTTCCTCGAGGAACGTGGTTGTCGTGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2885s21c1
Sequence:CCGGTGAAATAAGCCTCGCCAGGAACTCGAGTTCCTGGCGAGGCTTATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3460s21c1
Sequence:CCGGTGCGTCCCGAAGGCTTCTCTACTCGAGTAGAGAAGCCTTCGGGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2918s21c1
Sequence:CCGGTGGATGCCCGAACAACCATAGCTCGAGCTATGGTTGTTCGGGCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181722
LINC00174 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 174
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181722.2-4222s21c1
Sequence:CCGGGTATTCCCTTCTTCGGGATACCTCGAGGTATCCCGAAGAAGGGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3129s21c1
Sequence:CCGGTGCCTCACGACAACCACGTTCCTCGAGGAACGTGGTTGTCGTGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2885s21c1
Sequence:CCGGTGAAATAAGCCTCGCCAGGAACTCGAGTTCCTGGCGAGGCTTATTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-3460s21c1
Sequence:CCGGTGCGTCCCGAAGGCTTCTCTACTCGAGTAGAGAAGCCTTCGGGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181722.2-2918s21c1
Sequence:CCGGTGGATGCCCGAACAACCATAGCTCGAGCTATGGTTGTTCGGGCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)