EMAIL THIS PAGE TO A FRIEND

LINC00176

long intergenic non-protein coding RNA 176

37 Gene Product Result for
Synonyms: NCRNA00176 PRR17
Species: Human LINC00176(284739)
UniProtKB ID: Q6ZNR8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207349 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207349 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194233 predicted 641
2 SASI_Hs01_00194234 predicted 512
3 SASI_Hs01_00194235 predicted 1032
4 SASI_Hs01_00194236 predicted 506
5 SASI_Hs01_00194237 predicted 605
6 SASI_Hs01_00194238 predicted 777
7 SASI_Hs01_00194239 predicted 499
8 SASI_Hs01_00194240 predicted 1064
9 SASI_Hs01_00194242 predicted 927
10 SASI_Hs02_00373906 predicted 1026
11 SASI_Hs01_00194241 predicted 1061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207349
LINC00176 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 176
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207349.1-937s21c1
Sequence:CCGGTATCCGTCCTGCTCCACTTTGCTCGAGCAAAGTGGAGCAGGACGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-652s21c1
Sequence:CCGGAGGCCTCAATAAACGGAGCTGCTCGAGCAGCTCCGTTTATTGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-512s21c1
Sequence:CCGGCGCCTCGTTCTGTAGACTTGTCTCGAGACAAGTCTACAGAACGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-163s21c1
Sequence:CCGGAGTATCCTCCTGTCCATCTCGCTCGAGCGAGATGGACAGGAGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-517s1c1
Sequence:CCGGCGTTCTGTAGACTTGTTGGTGCTCGAGCACCAACAAGTCTACAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-518s1c1
Sequence:CCGGGTTCTGTAGACTTGTTGGTGACTCGAGTCACCAACAAGTCTACAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-521s21c1
Sequence:CCGGCTGTAGACTTGTTGGTGACCTCTCGAGAGGTCACCAACAAGTCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207349
LINC00176 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 176
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207349.1-937s21c1
Sequence:CCGGTATCCGTCCTGCTCCACTTTGCTCGAGCAAAGTGGAGCAGGACGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-652s21c1
Sequence:CCGGAGGCCTCAATAAACGGAGCTGCTCGAGCAGCTCCGTTTATTGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-512s21c1
Sequence:CCGGCGCCTCGTTCTGTAGACTTGTCTCGAGACAAGTCTACAGAACGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-163s21c1
Sequence:CCGGAGTATCCTCCTGTCCATCTCGCTCGAGCGAGATGGACAGGAGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-517s1c1
Sequence:CCGGCGTTCTGTAGACTTGTTGGTGCTCGAGCACCAACAAGTCTACAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-518s1c1
Sequence:CCGGGTTCTGTAGACTTGTTGGTGACTCGAGTCACCAACAAGTCTACAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-521s21c1
Sequence:CCGGCTGTAGACTTGTTGGTGACCTCTCGAGAGGTCACCAACAAGTCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207349
LINC00176 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 176
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207349.1-937s21c1
Sequence:CCGGTATCCGTCCTGCTCCACTTTGCTCGAGCAAAGTGGAGCAGGACGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-652s21c1
Sequence:CCGGAGGCCTCAATAAACGGAGCTGCTCGAGCAGCTCCGTTTATTGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-512s21c1
Sequence:CCGGCGCCTCGTTCTGTAGACTTGTCTCGAGACAAGTCTACAGAACGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-163s21c1
Sequence:CCGGAGTATCCTCCTGTCCATCTCGCTCGAGCGAGATGGACAGGAGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-517s1c1
Sequence:CCGGCGTTCTGTAGACTTGTTGGTGCTCGAGCACCAACAAGTCTACAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207349.1-518s1c1
Sequence:CCGGGTTCTGTAGACTTGTTGGTGACTCGAGTCACCAACAAGTCTACAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207349.1-521s21c1
Sequence:CCGGCTGTAGACTTGTTGGTGACCTCTCGAGAGGTCACCAACAAGTCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)