EMAIL THIS PAGE TO A FRIEND

LINC00200

long intergenic non-protein coding RNA 200

22 Gene Product Result for
Synonyms: C10orf139 NCRNA00200 RP11-529L18.1
Species: Human LINC00200(399706)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010910 Rosetta Predictions human pricing
NR_015376 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046792 predicted 227
2 SASI_Hs01_00046793 predicted 260
3 SASI_Hs01_00046794 predicted 543
4 SASI_Hs01_00046795 predicted 580
5 SASI_Hs01_00046796 predicted 485
6 SASI_Hs01_00046797 predicted 597
7 SASI_Hs01_00046798 predicted 565
8 SASI_Hs01_00046799 predicted 554
9 SASI_Hs01_00046800 predicted 629
10 SASI_Hs01_00046801 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381334 predicted 227
2 SASI_Hs02_00381335 predicted 991
3 SASI_Hs02_00381336 predicted 251
4 SASI_Hs02_00381337 predicted 476
5 SASI_Hs02_00381338 predicted 594
6 SASI_Hs02_00381339 predicted 555
7 SASI_Hs02_00381340 predicted 1038
8 SASI_Hs02_00381341 predicted 620
9 SASI_Hs02_00381342 predicted 575
10 SASI_Hs02_00381343 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010910
LINC00200 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 200
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-91s1c1
Sequence:CCGGCGCCTCACGCTTTATGTACATCTCGAGATGTACATAAAGCGTGAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010910.1-93s1c1
Sequence:CCGGCCTCACGCTTTATGTACATGACTCGAGTCATGTACATAAAGCGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1344s1c1
Sequence:CCGGCGATGCGTTCTTTATACACAACTCGAGTTGTGTATAAAGAACGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1049s1c1
Sequence:CCGGGCAAACTCTTACAGTGAGTATCTCGAGATACTCACTGTAAGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-262s1c1
Sequence:CCGGGACTGCACATATAACACAGCTCTCGAGAGCTGTGTTATATGTGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-128s1c1
Sequence:CCGGCAGGAATTGGCACAACCTGAACTCGAGTTCAGGTTGTGCCAATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010910
LINC00200 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 200
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-91s1c1
Sequence:CCGGCGCCTCACGCTTTATGTACATCTCGAGATGTACATAAAGCGTGAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010910.1-93s1c1
Sequence:CCGGCCTCACGCTTTATGTACATGACTCGAGTCATGTACATAAAGCGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1344s1c1
Sequence:CCGGCGATGCGTTCTTTATACACAACTCGAGTTGTGTATAAAGAACGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1049s1c1
Sequence:CCGGGCAAACTCTTACAGTGAGTATCTCGAGATACTCACTGTAAGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-262s1c1
Sequence:CCGGGACTGCACATATAACACAGCTCTCGAGAGCTGTGTTATATGTGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-128s1c1
Sequence:CCGGCAGGAATTGGCACAACCTGAACTCGAGTTCAGGTTGTGCCAATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010910
LINC00200 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 200
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-91s1c1
Sequence:CCGGCGCCTCACGCTTTATGTACATCTCGAGATGTACATAAAGCGTGAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010910.1-93s1c1
Sequence:CCGGCCTCACGCTTTATGTACATGACTCGAGTCATGTACATAAAGCGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1344s1c1
Sequence:CCGGCGATGCGTTCTTTATACACAACTCGAGTTGTGTATAAAGAACGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010910.1-1049s1c1
Sequence:CCGGGCAAACTCTTACAGTGAGTATCTCGAGATACTCACTGTAAGAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-262s1c1
Sequence:CCGGGACTGCACATATAACACAGCTCTCGAGAGCTGTGTTATATGTGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010910.1-128s1c1
Sequence:CCGGCAGGAATTGGCACAACCTGAACTCGAGTTCAGGTTGTGCCAATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)