EMAIL THIS PAGE TO A FRIEND

LINC00207

long intergenic non-protein coding RNA 207

11 Gene Product Result for
Synonyms: NCRNA00207
Species: Human LINC00207(388910)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012986 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012986 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180961 predicted 443
2 SASI_Hs01_00180962 predicted 449
3 SASI_Hs01_00180963 predicted 470
4 SASI_Hs01_00180964 predicted 466
5 SASI_Hs01_00180965 predicted 470
6 SASI_Hs01_00180966 predicted 441
7 SASI_Hs01_00180967 predicted 438
8 SASI_Hs01_00180968 predicted 466
9 SASI_Hs01_00180969 predicted 477
10 SASI_Hs01_00180970 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012986
LINC00207 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 207
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-121s1c1
Sequence:CCGGGAATGGATGGTTACACATCCTCTCGAGAGGATGTGTAACCATCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-374s1c1
Sequence:CCGGCAGAATCAGATGAAGACTCCTCTCGAGAGGAGTCTTCATCTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-142s1c1
Sequence:CCGGGCTTGGGATCCAATCACTGAACTCGAGTTCAGTGATTGGATCCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-299s21c1
Sequence:CCGGAGGCTGGACTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGTCCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-115s21c1
Sequence:CCGGAGAGGAGAATGGATGGTTACACTCGAGTGTAACCATCCATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012986.1-444s21c1
Sequence:CCGGAGCAGTGGCGATGAGTGAACACTCGAGTGTTCACTCATCGCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-93s21c1
Sequence:CCGGGTGACATGGGAGTTCTGTTTACTCGAGTAAACAGAACTCCCATGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-397s21c1
Sequence:CCGGTGCTGCATCTTGAAGATAATGCTCGAGCATTATCTTCAAGATGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012986
LINC00207 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 207
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-121s1c1
Sequence:CCGGGAATGGATGGTTACACATCCTCTCGAGAGGATGTGTAACCATCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-374s1c1
Sequence:CCGGCAGAATCAGATGAAGACTCCTCTCGAGAGGAGTCTTCATCTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-142s1c1
Sequence:CCGGGCTTGGGATCCAATCACTGAACTCGAGTTCAGTGATTGGATCCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-299s21c1
Sequence:CCGGAGGCTGGACTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGTCCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-115s21c1
Sequence:CCGGAGAGGAGAATGGATGGTTACACTCGAGTGTAACCATCCATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012986.1-444s21c1
Sequence:CCGGAGCAGTGGCGATGAGTGAACACTCGAGTGTTCACTCATCGCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-93s21c1
Sequence:CCGGGTGACATGGGAGTTCTGTTTACTCGAGTAAACAGAACTCCCATGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-397s21c1
Sequence:CCGGTGCTGCATCTTGAAGATAATGCTCGAGCATTATCTTCAAGATGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012986
LINC00207 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 207
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-121s1c1
Sequence:CCGGGAATGGATGGTTACACATCCTCTCGAGAGGATGTGTAACCATCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-374s1c1
Sequence:CCGGCAGAATCAGATGAAGACTCCTCTCGAGAGGAGTCTTCATCTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012986.1-142s1c1
Sequence:CCGGGCTTGGGATCCAATCACTGAACTCGAGTTCAGTGATTGGATCCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-299s21c1
Sequence:CCGGAGGCTGGACTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGTCCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-115s21c1
Sequence:CCGGAGAGGAGAATGGATGGTTACACTCGAGTGTAACCATCCATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012986.1-444s21c1
Sequence:CCGGAGCAGTGGCGATGAGTGAACACTCGAGTGTTCACTCATCGCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-93s21c1
Sequence:CCGGGTGACATGGGAGTTCTGTTTACTCGAGTAAACAGAACTCCCATGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012986.1-397s21c1
Sequence:CCGGTGCTGCATCTTGAAGATAATGCTCGAGCATTATCTTCAAGATGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)