EMAIL THIS PAGE TO A FRIEND

LINC00238

long intergenic non-protein coding RNA 238

108 Gene Product Result for
Synonyms: C14orf53 NCRNA00238
Species: Human LINC00238(440184)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004331 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004331 Rosetta Predictions human pricing
XR_041746 Rosetta Predictions human pricing
XR_041747 Rosetta Predictions human pricing
XR_041748 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108945 predicted 776
2 SASI_Hs01_00108946 predicted 826
3 SASI_Hs01_00108947 predicted 477
4 SASI_Hs01_00108948 predicted 673
5 SASI_Hs01_00108949 predicted 476
6 SASI_Hs01_00108950 predicted 741
7 SASI_Hs01_00108951 predicted 241
8 SASI_Hs01_00108952 predicted 443
9 SASI_Hs01_00108953 predicted 819
10 SASI_Hs01_00108954 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530031 predicted 773
2 SASI_Hs02_00530032 predicted 818
3 SASI_Hs02_00530033 predicted 461
4 SASI_Hs02_00530034 predicted 473
5 SASI_Hs02_00530035 predicted 665
6 SASI_Hs02_00530036 predicted 469
7 SASI_Hs02_00530037 predicted 243
8 SASI_Hs02_00530038 predicted 443
9 SASI_Hs02_00530039 predicted 681
10 SASI_Hs02_00530040 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530041 predicted 776
2 SASI_Hs02_00530042 predicted 827
3 SASI_Hs02_00530043 predicted 454
4 SASI_Hs02_00530044 predicted 477
5 SASI_Hs02_00530045 predicted 661
6 SASI_Hs02_00530046 predicted 471
7 SASI_Hs02_00530047 predicted 238
8 SASI_Hs02_00530048 predicted 441
9 SASI_Hs02_00530049 predicted 679
10 SASI_Hs02_00530050 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530051 predicted 769
2 SASI_Hs02_00530052 predicted 827
3 SASI_Hs02_00530053 predicted 457
4 SASI_Hs02_00530054 predicted 476
5 SASI_Hs02_00530055 predicted 668
6 SASI_Hs02_00530056 predicted 467
7 SASI_Hs02_00530057 predicted 243
8 SASI_Hs02_00530058 predicted 443
9 SASI_Hs02_00530059 predicted 675
10 SASI_Hs02_00530060 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004331
LINC00238 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 238
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-236s1c1
Sequence:CCGGGAGATGCTCAAACCTCTAGAACTCGAGTTCTAGAGGTTTGAGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-563s1c1
Sequence:CCGGGAATGGGTCAAGTATCAGGAACTCGAGTTCCTGATACTTGACCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-473s1c1
Sequence:CCGGGCAGAAGAACTTAGTGATCAACTCGAGTTGATCACTAAGTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-628s1c1
Sequence:CCGGGCTGAGAATTGAAGCCTTGAACTCGAGTTCAAGGCTTCAATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004331.1-817s1c1
Sequence:CCGGCAGACATCTGACAAAGCATTTCTCGAGAAATGCTTTGTCAGATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-395s1c1
Sequence:CCGGGAGATGAAACAGAACTTGGAACTCGAGTTCCAAGTTCTGTTTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004331
LINC00238 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 238
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-236s1c1
Sequence:CCGGGAGATGCTCAAACCTCTAGAACTCGAGTTCTAGAGGTTTGAGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-563s1c1
Sequence:CCGGGAATGGGTCAAGTATCAGGAACTCGAGTTCCTGATACTTGACCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-473s1c1
Sequence:CCGGGCAGAAGAACTTAGTGATCAACTCGAGTTGATCACTAAGTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-628s1c1
Sequence:CCGGGCTGAGAATTGAAGCCTTGAACTCGAGTTCAAGGCTTCAATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004331.1-817s1c1
Sequence:CCGGCAGACATCTGACAAAGCATTTCTCGAGAAATGCTTTGTCAGATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-395s1c1
Sequence:CCGGGAGATGAAACAGAACTTGGAACTCGAGTTCCAAGTTCTGTTTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004331
LINC00238 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 238
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-236s1c1
Sequence:CCGGGAGATGCTCAAACCTCTAGAACTCGAGTTCTAGAGGTTTGAGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-563s1c1
Sequence:CCGGGAATGGGTCAAGTATCAGGAACTCGAGTTCCTGATACTTGACCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-473s1c1
Sequence:CCGGGCAGAAGAACTTAGTGATCAACTCGAGTTGATCACTAAGTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-628s1c1
Sequence:CCGGGCTGAGAATTGAAGCCTTGAACTCGAGTTCAAGGCTTCAATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004331.1-817s1c1
Sequence:CCGGCAGACATCTGACAAAGCATTTCTCGAGAAATGCTTTGTCAGATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004331.1-395s1c1
Sequence:CCGGGAGATGAAACAGAACTTGGAACTCGAGTTCCAAGTTCTGTTTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)