EMAIL THIS PAGE TO A FRIEND

LINC00242

long intergenic non-protein coding RNA 242

43 Gene Product Result for
Synonyms: C6orf122 NCRNA00242 dJ266L20.5
Species: Human LINC00242(401288)
UniProtKB ID: Q5T6M2, Q0VD89, Q96N37
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207502 Rosetta Predictions human pricing
XR_040753 Rosetta Predictions human pricing
XR_040754 Rosetta Predictions human pricing
XR_040755 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075454 predicted 1061
2 SASI_Hs01_00075455 predicted 1164
3 SASI_Hs01_00075456 predicted 1056
4 SASI_Hs01_00075457 predicted 625
5 SASI_Hs01_00075458 predicted 1063
6 SASI_Hs01_00075459 predicted 1217
7 SASI_Hs01_00075460 predicted 645
8 SASI_Hs01_00075461 predicted 981
9 SASI_Hs01_00075462 predicted 627
10 SASI_Hs01_00075463 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521631 predicted 1056
2 SASI_Hs02_00521632 predicted 244
3 SASI_Hs02_00521633 predicted 1154
4 SASI_Hs02_00521634 predicted 1053
5 SASI_Hs02_00521635 predicted 465
6 SASI_Hs02_00521636 predicted 1890
7 SASI_Hs02_00521637 predicted 525
8 SASI_Hs02_00521638 predicted 973
9 SASI_Hs02_00521639 predicted 1143
10 SASI_Hs02_00521640 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521641 predicted 1058
2 SASI_Hs02_00521642 predicted 245
3 SASI_Hs02_00521643 predicted 1156
4 SASI_Hs02_00521644 predicted 1045
5 SASI_Hs02_00521645 predicted 458
6 SASI_Hs02_00521646 predicted 1895
7 SASI_Hs02_00521647 predicted 524
8 SASI_Hs02_00521648 predicted 978
9 SASI_Hs02_00521649 predicted 1138
10 SASI_Hs02_00521650 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521651 predicted 1056
2 SASI_Hs02_00521652 predicted 245
3 SASI_Hs02_00521653 predicted 1156
4 SASI_Hs02_00521654 predicted 1044
5 SASI_Hs02_00521655 predicted 464
6 SASI_Hs02_00521656 predicted 1893
7 SASI_Hs02_00521657 predicted 519
8 SASI_Hs02_00521658 predicted 971
9 SASI_Hs02_00521659 predicted 1146
10 SASI_Hs02_00521660 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207502
LINC00242 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 242
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-986s1c1
Sequence:CCGGCAAAGTCCATTCACAAGAGGACTCGAGTCCTCTTGTGAATGGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2113s1c1
Sequence:CCGGCCTGCAATATTCACTGAGGAACTCGAGTTCCTCAGTGAATATTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-1800s1c1
Sequence:CCGGGCTTGTTGAAAGCACTCACATCTCGAGATGTGAGTGCTTTCAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-757s1c1
Sequence:CCGGGATTCGCAAAGGAACAAGGAACTCGAGTTCCTTGTTCCTTTGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-756s1c1
Sequence:CCGGCGATTCGCAAAGGAACAAGGACTCGAGTCCTTGTTCCTTTGCGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-752s1c1
Sequence:CCGGCCATCGATTCGCAAAGGAACACTCGAGTGTTCCTTTGCGAATCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-1008s1c1
Sequence:CCGGCTTCTCCGCCAAATCGTTGAACTCGAGTTCAACGATTTGGCGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207502.1-1439s1c1
Sequence:CCGGCGTTTCTTTCCTCCCAGCATACTCGAGTATGCTGGGAGGAAAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2179s1c1
Sequence:CCGGCGAGTGGCACACAGCATTATTCTCGAGAATAATGCTGTGTGCCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-990s1c1
Sequence:CCGGGTCCATTCACAAGAGGAGCTTCTCGAGAAGCTCCTCTTGTGAATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-980s1c1
Sequence:CCGGGAAATCCAAAGTCCATTCACACTCGAGTGTGAATGGACTTTGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207502
LINC00242 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 242
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-986s1c1
Sequence:CCGGCAAAGTCCATTCACAAGAGGACTCGAGTCCTCTTGTGAATGGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2113s1c1
Sequence:CCGGCCTGCAATATTCACTGAGGAACTCGAGTTCCTCAGTGAATATTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-1800s1c1
Sequence:CCGGGCTTGTTGAAAGCACTCACATCTCGAGATGTGAGTGCTTTCAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-757s1c1
Sequence:CCGGGATTCGCAAAGGAACAAGGAACTCGAGTTCCTTGTTCCTTTGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-756s1c1
Sequence:CCGGCGATTCGCAAAGGAACAAGGACTCGAGTCCTTGTTCCTTTGCGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-752s1c1
Sequence:CCGGCCATCGATTCGCAAAGGAACACTCGAGTGTTCCTTTGCGAATCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-1008s1c1
Sequence:CCGGCTTCTCCGCCAAATCGTTGAACTCGAGTTCAACGATTTGGCGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207502.1-1439s1c1
Sequence:CCGGCGTTTCTTTCCTCCCAGCATACTCGAGTATGCTGGGAGGAAAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2179s1c1
Sequence:CCGGCGAGTGGCACACAGCATTATTCTCGAGAATAATGCTGTGTGCCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-990s1c1
Sequence:CCGGGTCCATTCACAAGAGGAGCTTCTCGAGAAGCTCCTCTTGTGAATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-980s1c1
Sequence:CCGGGAAATCCAAAGTCCATTCACACTCGAGTGTGAATGGACTTTGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207502
LINC00242 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 242
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-986s1c1
Sequence:CCGGCAAAGTCCATTCACAAGAGGACTCGAGTCCTCTTGTGAATGGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2113s1c1
Sequence:CCGGCCTGCAATATTCACTGAGGAACTCGAGTTCCTCAGTGAATATTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-1800s1c1
Sequence:CCGGGCTTGTTGAAAGCACTCACATCTCGAGATGTGAGTGCTTTCAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207502.1-757s1c1
Sequence:CCGGGATTCGCAAAGGAACAAGGAACTCGAGTTCCTTGTTCCTTTGCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-756s1c1
Sequence:CCGGCGATTCGCAAAGGAACAAGGACTCGAGTCCTTGTTCCTTTGCGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-752s1c1
Sequence:CCGGCCATCGATTCGCAAAGGAACACTCGAGTGTTCCTTTGCGAATCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-1008s1c1
Sequence:CCGGCTTCTCCGCCAAATCGTTGAACTCGAGTTCAACGATTTGGCGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207502.1-1439s1c1
Sequence:CCGGCGTTTCTTTCCTCCCAGCATACTCGAGTATGCTGGGAGGAAAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207502.1-2179s1c1
Sequence:CCGGCGAGTGGCACACAGCATTATTCTCGAGAATAATGCTGTGTGCCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-990s1c1
Sequence:CCGGGTCCATTCACAAGAGGAGCTTCTCGAGAAGCTCCTCTTGTGAATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207502.1-980s1c1
Sequence:CCGGGAAATCCAAAGTCCATTCACACTCGAGTGTGAATGGACTTTGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376557
LINC00242 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 242
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-1063s1c1
Sequence:CCGGGCTTTAGTCAGCCGTACGAAACTCGAGTTTCGTACGGCTGACTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-768s1c1
Sequence:CCGGGAACAAGGAAAGAACACGTTTCTCGAGAAACGTGTTCTTTCCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-761s1c1
Sequence:CCGGCGCAAAGGAACAAGGAAAGAACTCGAGTTCTTTCCTTGTTCCTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376557
LINC00242 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 242
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-1063s1c1
Sequence:CCGGGCTTTAGTCAGCCGTACGAAACTCGAGTTTCGTACGGCTGACTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-768s1c1
Sequence:CCGGGAACAAGGAAAGAACACGTTTCTCGAGAAACGTGTTCTTTCCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-761s1c1
Sequence:CCGGCGCAAAGGAACAAGGAAAGAACTCGAGTTCTTTCCTTGTTCCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376557
LINC00242 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 242
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-1063s1c1
Sequence:CCGGGCTTTAGTCAGCCGTACGAAACTCGAGTTTCGTACGGCTGACTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-768s1c1
Sequence:CCGGGAACAAGGAAAGAACACGTTTCTCGAGAAACGTGTTCTTTCCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376557.1-761s1c1
Sequence:CCGGCGCAAAGGAACAAGGAAAGAACTCGAGTTCTTTCCTTGTTCCTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)