EMAIL THIS PAGE TO A FRIEND

LINC00268

long intergenic non-protein coding RNA 268

165 Gene Product Result for
Synonyms: NCRNA00268 NCRNA00268A
Species: Human LINC00268(441426)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013727 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013727 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238105 predicted 430
2 SASI_Hs01_00238106 predicted 437
3 SASI_Hs01_00238107 predicted 514
4 SASI_Hs01_00238108 predicted 422
5 SASI_Hs01_00238109 predicted 434
6 SASI_Hs01_00238110 predicted 377
7 SASI_Hs01_00238111 predicted 517
8 SASI_Hs01_00238112 predicted 525
9 SASI_Hs01_00238113 predicted 1670
10 SASI_Hs01_00238114 predicted 1683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013727
LINC00268 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 268
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-574s1c1
Sequence:CCGGCATTTCCAGTCAGTATTTGAACTCGAGTTCAAATACTGACTGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-432s1c1
Sequence:CCGGCTCTACCTATTTCTACCTATTCTCGAGAATAGGTAGAAATAGGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013727
LINC00268 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 268
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-574s1c1
Sequence:CCGGCATTTCCAGTCAGTATTTGAACTCGAGTTCAAATACTGACTGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-432s1c1
Sequence:CCGGCTCTACCTATTTCTACCTATTCTCGAGAATAGGTAGAAATAGGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013727
LINC00268 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 268
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-574s1c1
Sequence:CCGGCATTTCCAGTCAGTATTTGAACTCGAGTTCAAATACTGACTGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013727.1-432s1c1
Sequence:CCGGCTCTACCTATTTCTACCTATTCTCGAGAATAGGTAGAAATAGGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)