EMAIL THIS PAGE TO A FRIEND

LINC00272

long intergenic non-protein coding RNA 272

12 Gene Product Result for
Synonyms: C1orf120 NCRNA00272 RP1-223H12.3
Species: Human LINC00272(388719)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010899 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010899 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042342 predicted 439
2 SASI_Hs01_00042343 predicted 307
3 SASI_Hs01_00042344 predicted 454
4 SASI_Hs01_00042345 predicted 325
5 SASI_Hs01_00042346 predicted 357
6 SASI_Hs01_00042347 predicted 431
7 SASI_Hs01_00042348 predicted 442
8 SASI_Hs01_00042349 predicted 385
9 SASI_Hs01_00042350 predicted 307
10 SASI_Hs01_00042351 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010899
LINC00272 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 272
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-528s1c1
Sequence:CCGGCATCGCAATTACACCATTATTCTCGAGAATAATGGTGTAATTGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-527s1c1
Sequence:CCGGGCATCGCAATTACACCATTATCTCGAGATAATGGTGTAATTGCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010899.1-588s1c1
Sequence:CCGGGAGGAAGTGGCTTTGGCAAATCTCGAGATTTGCCAAAGCCACTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-531s1c1
Sequence:CCGGCGCAATTACACCATTATTGCACTCGAGTGCAATAATGGTGTAATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-509s1c1
Sequence:CCGGCATTTCCAAGTTATGGTGGCACTCGAGTGCCACCATAACTTGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-414s1c1
Sequence:CCGGGAATAGCTCCAGGAGAGGGAACTCGAGTTCCCTCTCCTGGAGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010899
LINC00272 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 272
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-528s1c1
Sequence:CCGGCATCGCAATTACACCATTATTCTCGAGAATAATGGTGTAATTGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-527s1c1
Sequence:CCGGGCATCGCAATTACACCATTATCTCGAGATAATGGTGTAATTGCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010899.1-588s1c1
Sequence:CCGGGAGGAAGTGGCTTTGGCAAATCTCGAGATTTGCCAAAGCCACTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-531s1c1
Sequence:CCGGCGCAATTACACCATTATTGCACTCGAGTGCAATAATGGTGTAATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-509s1c1
Sequence:CCGGCATTTCCAAGTTATGGTGGCACTCGAGTGCCACCATAACTTGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-414s1c1
Sequence:CCGGGAATAGCTCCAGGAGAGGGAACTCGAGTTCCCTCTCCTGGAGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010899
LINC00272 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 272
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-528s1c1
Sequence:CCGGCATCGCAATTACACCATTATTCTCGAGAATAATGGTGTAATTGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-527s1c1
Sequence:CCGGGCATCGCAATTACACCATTATCTCGAGATAATGGTGTAATTGCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010899.1-588s1c1
Sequence:CCGGGAGGAAGTGGCTTTGGCAAATCTCGAGATTTGCCAAAGCCACTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-531s1c1
Sequence:CCGGCGCAATTACACCATTATTGCACTCGAGTGCAATAATGGTGTAATTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-509s1c1
Sequence:CCGGCATTTCCAAGTTATGGTGGCACTCGAGTGCCACCATAACTTGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010899.1-414s1c1
Sequence:CCGGGAATAGCTCCAGGAGAGGGAACTCGAGTTCCCTCTCCTGGAGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)