EMAIL THIS PAGE TO A FRIEND

LINC00299

long intergenic non-protein coding RNA 299

42 Gene Product Result for
Synonyms: C2orf46 NCRNA00299
Species: Human LINC00299(339789)
UniProtKB ID: Q6ZSB3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207358 Rosetta Predictions human pricing
XR_040099 Rosetta Predictions human pricing
XR_040100 Rosetta Predictions human pricing
XR_040101 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201471 predicted 302
2 SASI_Hs01_00201472 predicted 336
3 SASI_Hs01_00201473 predicted 470
4 SASI_Hs01_00201474 predicted 364
5 SASI_Hs01_00201475 predicted 352
6 SASI_Hs01_00201476 predicted 331
7 SASI_Hs01_00201477 predicted 400
8 SASI_Hs01_00201478 predicted 286
9 SASI_Hs01_00201479 predicted 308
10 SASI_Hs01_00201480 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515879 predicted 295
2 SASI_Hs02_00515880 predicted 327
3 SASI_Hs02_00515881 predicted 287
4 SASI_Hs02_00515882 predicted 228
5 SASI_Hs02_00515883 predicted 216
6 SASI_Hs02_00515884 predicted 351
7 SASI_Hs02_00515885 predicted 335
8 SASI_Hs02_00515886 predicted 306
9 SASI_Hs02_00515887 predicted 231
10 SASI_Hs02_00515888 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515889 predicted 298
2 SASI_Hs02_00515890 predicted 328
3 SASI_Hs02_00515891 predicted 288
4 SASI_Hs02_00515892 predicted 229
5 SASI_Hs02_00515893 predicted 216
6 SASI_Hs02_00515894 predicted 346
7 SASI_Hs02_00515895 predicted 327
8 SASI_Hs02_00515896 predicted 312
9 SASI_Hs02_00515897 predicted 223
10 SASI_Hs02_00515898 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515899 predicted 304
2 SASI_Hs02_00515900 predicted 332
3 SASI_Hs02_00515901 predicted 286
4 SASI_Hs02_00515902 predicted 225
5 SASI_Hs02_00515903 predicted 214
6 SASI_Hs02_00515904 predicted 344
7 SASI_Hs02_00515905 predicted 329
8 SASI_Hs02_00515906 predicted 311
9 SASI_Hs02_00515907 predicted 232
10 SASI_Hs02_00515908 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207358
LINC00299 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 299
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-351s1c1
Sequence:CCGGGTGTTCAACACTGGCTGCATTCTCGAGAATGCAGCCAGTGTTGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1104s1c1
Sequence:CCGGGCACTCAAGAAATGTACCATTCTCGAGAATGGTACATTTCTTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-626s1c1
Sequence:CCGGCTAGAAGAAGCAAGTGAATTTCTCGAGAAATTCACTTGCTTCTTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1646s1c1
Sequence:CCGGGCATGGCATATTATTGCTATTCTCGAGAATAGCAATAATATGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207358
LINC00299 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 299
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-351s1c1
Sequence:CCGGGTGTTCAACACTGGCTGCATTCTCGAGAATGCAGCCAGTGTTGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1104s1c1
Sequence:CCGGGCACTCAAGAAATGTACCATTCTCGAGAATGGTACATTTCTTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-626s1c1
Sequence:CCGGCTAGAAGAAGCAAGTGAATTTCTCGAGAAATTCACTTGCTTCTTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1646s1c1
Sequence:CCGGGCATGGCATATTATTGCTATTCTCGAGAATAGCAATAATATGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207358
LINC00299 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 299
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-351s1c1
Sequence:CCGGGTGTTCAACACTGGCTGCATTCTCGAGAATGCAGCCAGTGTTGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1104s1c1
Sequence:CCGGGCACTCAAGAAATGTACCATTCTCGAGAATGGTACATTTCTTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207358.1-626s1c1
Sequence:CCGGCTAGAAGAAGCAAGTGAATTTCTCGAGAAATTCACTTGCTTCTTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207358.1-1646s1c1
Sequence:CCGGGCATGGCATATTATTGCTATTCTCGAGAATAGCAATAATATGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)