EMAIL THIS PAGE TO A FRIEND

LINC00301

long intergenic non-protein coding RNA 301

104 Gene Product Result for
Synonyms: C11orf64 NCRNA00301
Species: Human LINC00301(283197)
UniProtKB ID: Q8NCQ3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174939 Rosetta Predictions human pricing
XR_039987 Rosetta Predictions human pricing
XR_039988 Rosetta Predictions human pricing
XR_039989 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131504 predicted 251
2 SASI_Hs01_00131505 predicted 208
3 SASI_Hs01_00131506 predicted 318
4 SASI_Hs01_00131507 predicted 243
5 SASI_Hs01_00131508 predicted 338
6 SASI_Hs01_00131509 predicted 208
7 SASI_Hs01_00131510 predicted 343
8 SASI_Hs01_00131511 predicted 311
9 SASI_Hs01_00131512 predicted 245
10 SASI_Hs01_00131513 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514901 predicted 102
2 SASI_Hs02_00514902 predicted 181
3 SASI_Hs02_00514903 predicted 109
4 SASI_Hs02_00514904 predicted 97
5 SASI_Hs02_00514905 predicted 78
6 SASI_Hs02_00514906 predicted 242
7 SASI_Hs02_00514907 predicted 176
8 SASI_Hs02_00514908 predicted 203
9 SASI_Hs02_00514909 predicted 172
10 SASI_Hs02_00514910 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514911 predicted 105
2 SASI_Hs02_00514912 predicted 187
3 SASI_Hs02_00514913 predicted 114
4 SASI_Hs02_00514914 predicted 97
5 SASI_Hs02_00514915 predicted 79
6 SASI_Hs02_00514916 predicted 238
7 SASI_Hs02_00514917 predicted 177
8 SASI_Hs02_00514918 predicted 205
9 SASI_Hs02_00514919 predicted 171
10 SASI_Hs02_00514920 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514921 predicted 105
2 SASI_Hs02_00514922 predicted 180
3 SASI_Hs02_00514923 predicted 110
4 SASI_Hs02_00514924 predicted 101
5 SASI_Hs02_00514925 predicted 72
6 SASI_Hs02_00514926 predicted 235
7 SASI_Hs02_00514927 predicted 179
8 SASI_Hs02_00514928 predicted 205
9 SASI_Hs02_00514929 predicted 163
10 SASI_Hs02_00514930 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174939
LINC00301 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 301
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-199s1c1
Sequence:CCGGGAATTTAAACAGTTTCGGCCTCTCGAGAGGCCGAAACTGTTTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-293s1c1
Sequence:CCGGCCACATGTACCCAGTAACAGACTCGAGTCTGTTACTGGGTACATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-381s1c1
Sequence:CCGGGAGAAACTGCTCAGAGAACCTCTCGAGAGGTTCTCTGAGCAGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-436s1c1
Sequence:CCGGGCTCAGTTCATCAACTCAGGACTCGAGTCCTGAGTTGATGAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-508s1c1
Sequence:CCGGCGGAAATCTCACTGTCGGAATCTCGAGATTCCGACAGTGAGATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-376s1c1
Sequence:CCGGCCATAGAGAAACTGCTCAGAGCTCGAGCTCTGAGCAGTTTCTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-366s1c1
Sequence:CCGGCCTGGTGGTTCCATAGAGAAACTCGAGTTTCTCTATGGAACCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-184s1c1
Sequence:CCGGGTATGCCATATGGATGAATTTCTCGAGAAATTCATCCATATGGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174939
LINC00301 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 301
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-199s1c1
Sequence:CCGGGAATTTAAACAGTTTCGGCCTCTCGAGAGGCCGAAACTGTTTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-293s1c1
Sequence:CCGGCCACATGTACCCAGTAACAGACTCGAGTCTGTTACTGGGTACATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-381s1c1
Sequence:CCGGGAGAAACTGCTCAGAGAACCTCTCGAGAGGTTCTCTGAGCAGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-436s1c1
Sequence:CCGGGCTCAGTTCATCAACTCAGGACTCGAGTCCTGAGTTGATGAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-508s1c1
Sequence:CCGGCGGAAATCTCACTGTCGGAATCTCGAGATTCCGACAGTGAGATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-376s1c1
Sequence:CCGGCCATAGAGAAACTGCTCAGAGCTCGAGCTCTGAGCAGTTTCTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-366s1c1
Sequence:CCGGCCTGGTGGTTCCATAGAGAAACTCGAGTTTCTCTATGGAACCACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-184s1c1
Sequence:CCGGGTATGCCATATGGATGAATTTCTCGAGAAATTCATCCATATGGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174939
LINC00301 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 301
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-199s1c1
Sequence:CCGGGAATTTAAACAGTTTCGGCCTCTCGAGAGGCCGAAACTGTTTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-293s1c1
Sequence:CCGGCCACATGTACCCAGTAACAGACTCGAGTCTGTTACTGGGTACATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-381s1c1
Sequence:CCGGGAGAAACTGCTCAGAGAACCTCTCGAGAGGTTCTCTGAGCAGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-436s1c1
Sequence:CCGGGCTCAGTTCATCAACTCAGGACTCGAGTCCTGAGTTGATGAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174939.2-508s1c1
Sequence:CCGGCGGAAATCTCACTGTCGGAATCTCGAGATTCCGACAGTGAGATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174939.2-376s1c1
Sequence:CCGGCCATAGAGAAACTGCTCAGAGCTCGAGCTCTGAGCAGTTTCTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-366s1c1
Sequence:CCGGCCTGGTGGTTCCATAGAGAAACTCGAGTTTCTCTATGGAACCACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174939.2-184s1c1
Sequence:CCGGGTATGCCATATGGATGAATTTCTCGAGAAATTCATCCATATGGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)