EMAIL THIS PAGE TO A FRIEND

LINC00304

long intergenic non-protein coding RNA 304

32 Gene Product Result for
Synonyms: C16orf81 NCRNA00304
Species: Human LINC00304(283860)
UniProtKB ID: Q8N9R0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126835 Rosetta Predictions human pricing
XM_001134340 Rosetta Predictions human pricing
XM_001719860 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383244 predicted 249
2 SASI_Hs02_00383245 predicted 250
3 SASI_Hs02_00383246 predicted 196
4 SASI_Hs02_00383247 predicted 245
5 SASI_Hs02_00383248 predicted 273
6 SASI_Hs02_00383249 predicted 441
7 SASI_Hs02_00383250 predicted 280
8 SASI_Hs02_00383251 predicted 409
9 SASI_Hs02_00383252 predicted 443
10 SASI_Hs02_00383253 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001134340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392183 predicted 242
2 SASI_Hs02_00392184 predicted 246
3 SASI_Hs02_00392185 predicted 202
4 SASI_Hs02_00392186 predicted 246
5 SASI_Hs02_00392187 predicted 276
6 SASI_Hs02_00392188 predicted 444
7 SASI_Hs02_00392189 predicted 281
8 SASI_Hs02_00392190 predicted 408
9 SASI_Hs02_00392191 predicted 442
10 SASI_Hs02_00392192 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433006 predicted 250
2 SASI_Hs02_00433007 predicted 247
3 SASI_Hs02_00433008 predicted 200
4 SASI_Hs02_00433009 predicted 245
5 SASI_Hs02_00433010 predicted 275
6 SASI_Hs02_00433011 predicted 442
7 SASI_Hs02_00433012 predicted 282
8 SASI_Hs02_00433013 predicted 406
9 SASI_Hs02_00433014 predicted 436
10 SASI_Hs02_00433015 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173617
LINC00304 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 304
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1624s1c1
Sequence:CCGGGAAGGCATGTTCCGGAAGTTTCTCGAGAAACTTCCGGAACATGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2010s1c1
Sequence:CCGGCCTGATTACAAGTCAGGTGGACTCGAGTCCACCTGACTTGTAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2021s1c1
Sequence:CCGGGTCAGGTGGAACATCTCGAATCTCGAGATTCGAGATGTTCCACCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1840s1c1
Sequence:CCGGCCAGATGTCTTCCACTTACTTCTCGAGAAGTAAGTGGAAGACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1788s1c1
Sequence:CCGGGAAGAATTTCTCCAGAAGATACTCGAGTATCTTCTGGAGAAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2038s1c1
Sequence:CCGGGAATATGTTTCTGGGCCATTTCTCGAGAAATGGCCCAGAAACATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2026s1c1
Sequence:CCGGGTGGAACATCTCGAATATGTTCTCGAGAACATATTCGAGATGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2023s1c1
Sequence:CCGGCAGGTGGAACATCTCGAATATCTCGAGATATTCGAGATGTTCCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1593s1c1
Sequence:CCGGGAAGCCACGTTCCAGAAGTTTCTCGAGAAACTTCTGGAACGTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173617
LINC00304 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 304
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1624s1c1
Sequence:CCGGGAAGGCATGTTCCGGAAGTTTCTCGAGAAACTTCCGGAACATGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2010s1c1
Sequence:CCGGCCTGATTACAAGTCAGGTGGACTCGAGTCCACCTGACTTGTAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2021s1c1
Sequence:CCGGGTCAGGTGGAACATCTCGAATCTCGAGATTCGAGATGTTCCACCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1840s1c1
Sequence:CCGGCCAGATGTCTTCCACTTACTTCTCGAGAAGTAAGTGGAAGACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1788s1c1
Sequence:CCGGGAAGAATTTCTCCAGAAGATACTCGAGTATCTTCTGGAGAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2038s1c1
Sequence:CCGGGAATATGTTTCTGGGCCATTTCTCGAGAAATGGCCCAGAAACATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2026s1c1
Sequence:CCGGGTGGAACATCTCGAATATGTTCTCGAGAACATATTCGAGATGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2023s1c1
Sequence:CCGGCAGGTGGAACATCTCGAATATCTCGAGATATTCGAGATGTTCCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1593s1c1
Sequence:CCGGGAAGCCACGTTCCAGAAGTTTCTCGAGAAACTTCTGGAACGTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173617
LINC00304 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 304
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1624s1c1
Sequence:CCGGGAAGGCATGTTCCGGAAGTTTCTCGAGAAACTTCCGGAACATGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2010s1c1
Sequence:CCGGCCTGATTACAAGTCAGGTGGACTCGAGTCCACCTGACTTGTAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2021s1c1
Sequence:CCGGGTCAGGTGGAACATCTCGAATCTCGAGATTCGAGATGTTCCACCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1840s1c1
Sequence:CCGGCCAGATGTCTTCCACTTACTTCTCGAGAAGTAAGTGGAAGACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1788s1c1
Sequence:CCGGGAAGAATTTCTCCAGAAGATACTCGAGTATCTTCTGGAGAAATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2038s1c1
Sequence:CCGGGAATATGTTTCTGGGCCATTTCTCGAGAAATGGCCCAGAAACATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2026s1c1
Sequence:CCGGGTGGAACATCTCGAATATGTTCTCGAGAACATATTCGAGATGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-2023s1c1
Sequence:CCGGCAGGTGGAACATCTCGAATATCTCGAGATATTCGAGATGTTCCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173617.1-1593s1c1
Sequence:CCGGGAAGCCACGTTCCAGAAGTTTCTCGAGAAACTTCTGGAACGTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)