EMAIL THIS PAGE TO A FRIEND

LINC00315

long intergenic non-protein coding RNA 315

40 Gene Product Result for
Synonyms: C21orf93 NCRNA00315
Species: Human LINC00315(246704)
UniProtKB ID: P59091
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145179 Rosetta Predictions human pricing
XR_041771 Rosetta Predictions human pricing
XR_041772 Rosetta Predictions human pricing
XR_041773 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169133 predicted 1605
2 SASI_Hs01_00169134 predicted 1467
3 SASI_Hs01_00169135 predicted 1164
4 SASI_Hs01_00169136 predicted 1501
5 SASI_Hs01_00169137 predicted 854
6 SASI_Hs01_00169138 predicted 846
7 SASI_Hs01_00169139 predicted 2194
8 SASI_Hs01_00169140 predicted 2030
9 SASI_Hs01_00169141 predicted 2092
10 SASI_Hs01_00169142 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530244 predicted 91
2 SASI_Hs02_00530245 predicted 190
3 SASI_Hs02_00530246 predicted 352
4 SASI_Hs02_00530247 predicted 33
5 SASI_Hs02_00530248 predicted 278
6 SASI_Hs02_00530249 predicted 354
7 SASI_Hs02_00530250 predicted 331
8 SASI_Hs02_00530251 predicted 261
9 SASI_Hs02_00530252 predicted 84
10 SASI_Hs02_00530253 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530254 predicted 83
2 SASI_Hs02_00530255 predicted 183
3 SASI_Hs02_00530256 predicted 350
4 SASI_Hs02_00530257 predicted 38
5 SASI_Hs02_00530258 predicted 279
6 SASI_Hs02_00530259 predicted 353
7 SASI_Hs02_00530260 predicted 325
8 SASI_Hs02_00530261 predicted 260
9 SASI_Hs02_00530262 predicted 87
10 SASI_Hs02_00530263 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530264 predicted 91
2 SASI_Hs02_00530265 predicted 185
3 SASI_Hs02_00530266 predicted 350
4 SASI_Hs02_00530267 predicted 39
5 SASI_Hs02_00530268 predicted 276
6 SASI_Hs02_00530269 predicted 354
7 SASI_Hs02_00530270 predicted 322
8 SASI_Hs02_00530271 predicted 260
9 SASI_Hs02_00530272 predicted 88
10 SASI_Hs02_00530273 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145179
LINC00315 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 315
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000195966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-2091s1c1
Sequence:CCGGCCTTCTCCTATCCGGAAAGTACTCGAGTACTTTCCGGATAGGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-1948s1c1
Sequence:CCGGGAAACTGAACATCTCCAAGTACTCGAGTACTTGGAGATGTTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145179
LINC00315 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 315
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000195966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-2091s1c1
Sequence:CCGGCCTTCTCCTATCCGGAAAGTACTCGAGTACTTTCCGGATAGGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-1948s1c1
Sequence:CCGGGAAACTGAACATCTCCAAGTACTCGAGTACTTGGAGATGTTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145179
LINC00315 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 315
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000195966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-2091s1c1
Sequence:CCGGCCTTCTCCTATCCGGAAAGTACTCGAGTACTTTCCGGATAGGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145179.1-1948s1c1
Sequence:CCGGGAAACTGAACATCTCCAAGTACTCGAGTACTTGGAGATGTTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)