EMAIL THIS PAGE TO A FRIEND

LINC00319

long intergenic non-protein coding RNA 319

42 Gene Product Result for
Synonyms: C21orf125 NCRNA00319 PRED49
Species: Human LINC00319(284836)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194309 Rosetta Predictions human pricing
XR_041147 Rosetta Predictions human pricing
XR_041148 Rosetta Predictions human pricing
XR_041149 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099451 predicted 622
2 SASI_Hs01_00099452 predicted 755
3 SASI_Hs01_00099453 predicted 367
4 SASI_Hs01_00099454 predicted 682
5 SASI_Hs01_00099455 predicted 757
6 SASI_Hs01_00099456 predicted 376
7 SASI_Hs01_00099457 predicted 311
8 SASI_Hs01_00099458 predicted 683
9 SASI_Hs01_00099459 predicted 331
10 SASI_Hs01_00099460 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525048 predicted 235
2 SASI_Hs02_00525049 predicted 233
3 SASI_Hs02_00525050 predicted 221
4 SASI_Hs02_00525051 predicted 231
5 SASI_Hs02_00525052 predicted 236
6 SASI_Hs02_00525053 predicted 217
7 SASI_Hs02_00525054 predicted 241
8 SASI_Hs02_00525055 predicted 232
9 SASI_Hs02_00525056 predicted 280
10 SASI_Hs02_00525057 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525058 predicted 241
2 SASI_Hs02_00525059 predicted 237
3 SASI_Hs02_00525060 predicted 225
4 SASI_Hs02_00525061 predicted 238
5 SASI_Hs02_00525062 predicted 233
6 SASI_Hs02_00525063 predicted 217
7 SASI_Hs02_00525064 predicted 239
8 SASI_Hs02_00525065 predicted 236
9 SASI_Hs02_00525066 predicted 282
10 SASI_Hs02_00525067 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525068 predicted 233
2 SASI_Hs02_00525069 predicted 236
3 SASI_Hs02_00525070 predicted 227
4 SASI_Hs02_00525071 predicted 237
5 SASI_Hs02_00525072 predicted 235
6 SASI_Hs02_00525073 predicted 221
7 SASI_Hs02_00525074 predicted 243
8 SASI_Hs02_00525075 predicted 239
9 SASI_Hs02_00525076 predicted 284
10 SASI_Hs02_00525077 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194309
LINC00319 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 319
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-377s1c1
Sequence:CCGGGACAAGAATCGATTTGAGTGACTCGAGTCACTCAAATCGATTCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-760s1c1
Sequence:CCGGCACTCCAACTTGGTATTGATTCTCGAGAATCAATACCAAGTTGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-198s1c1
Sequence:CCGGGCTGAACAAACGAGAACATCTCTCGAGAGATGTTCTCGTTTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-196s1c1
Sequence:CCGGCGGCTGAACAAACGAGAACATCTCGAGATGTTCTCGTTTGTTCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-685s1c1
Sequence:CCGGCCCACTTTGCAGGGATGTATTCTCGAGAATACATCCCTGCAAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-1606s1c1
Sequence:CCGGCACACTCCTATCTCTGCACTTCTCGAGAAGTGCAGAGATAGGAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-2257s1c1
Sequence:CCGGGCACAGGCATTTGTCATCCTTCTCGAGAAGGATGACAAATGCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-402s1c1
Sequence:CCGGGCGTGTCAATACAGGCCAGCACTCGAGTGCTGGCCTGTATTGACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194309.1-370s1c1
Sequence:CCGGCGGCTTTGACAAGAATCGATTCTCGAGAATCGATTCTTGTCAAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194309
LINC00319 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 319
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-377s1c1
Sequence:CCGGGACAAGAATCGATTTGAGTGACTCGAGTCACTCAAATCGATTCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-760s1c1
Sequence:CCGGCACTCCAACTTGGTATTGATTCTCGAGAATCAATACCAAGTTGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-198s1c1
Sequence:CCGGGCTGAACAAACGAGAACATCTCTCGAGAGATGTTCTCGTTTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-196s1c1
Sequence:CCGGCGGCTGAACAAACGAGAACATCTCGAGATGTTCTCGTTTGTTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-685s1c1
Sequence:CCGGCCCACTTTGCAGGGATGTATTCTCGAGAATACATCCCTGCAAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-1606s1c1
Sequence:CCGGCACACTCCTATCTCTGCACTTCTCGAGAAGTGCAGAGATAGGAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-2257s1c1
Sequence:CCGGGCACAGGCATTTGTCATCCTTCTCGAGAAGGATGACAAATGCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-402s1c1
Sequence:CCGGGCGTGTCAATACAGGCCAGCACTCGAGTGCTGGCCTGTATTGACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194309.1-370s1c1
Sequence:CCGGCGGCTTTGACAAGAATCGATTCTCGAGAATCGATTCTTGTCAAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194309
LINC00319 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 319
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-377s1c1
Sequence:CCGGGACAAGAATCGATTTGAGTGACTCGAGTCACTCAAATCGATTCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-760s1c1
Sequence:CCGGCACTCCAACTTGGTATTGATTCTCGAGAATCAATACCAAGTTGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-198s1c1
Sequence:CCGGGCTGAACAAACGAGAACATCTCTCGAGAGATGTTCTCGTTTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-196s1c1
Sequence:CCGGCGGCTGAACAAACGAGAACATCTCGAGATGTTCTCGTTTGTTCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-685s1c1
Sequence:CCGGCCCACTTTGCAGGGATGTATTCTCGAGAATACATCCCTGCAAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-1606s1c1
Sequence:CCGGCACACTCCTATCTCTGCACTTCTCGAGAAGTGCAGAGATAGGAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194309.1-2257s1c1
Sequence:CCGGGCACAGGCATTTGTCATCCTTCTCGAGAAGGATGACAAATGCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194309.1-402s1c1
Sequence:CCGGGCGTGTCAATACAGGCCAGCACTCGAGTGCTGGCCTGTATTGACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194309.1-370s1c1
Sequence:CCGGCGGCTTTGACAAGAATCGATTCTCGAGAATCGATTCTTGTCAAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)