EMAIL THIS PAGE TO A FRIEND

LINC00337

long intergenic non-protein coding RNA 337

40 Gene Product Result for
Synonyms: C1orf211 NCRNA00337
Species: Human LINC00337(148645)
UniProtKB ID: Q8N6G1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153709 Rosetta Predictions human pricing
XR_040929 Rosetta Predictions human pricing
XR_040930 Rosetta Predictions human pricing
XR_040931 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139393 predicted 944
2 SASI_Hs01_00139394 predicted 727
3 SASI_Hs01_00139395 predicted 787
4 SASI_Hs01_00139396 predicted 655
5 SASI_Hs01_00139397 predicted 746
6 SASI_Hs01_00139398 predicted 979
7 SASI_Hs01_00139399 predicted 743
8 SASI_Hs01_00139400 predicted 751
9 SASI_Hs01_00139401 predicted 979
10 SASI_Hs01_00139402 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523179 predicted 474
2 SASI_Hs02_00523180 predicted 261
3 SASI_Hs02_00523181 predicted 327
4 SASI_Hs02_00523182 predicted 272
5 SASI_Hs02_00523183 predicted 512
6 SASI_Hs02_00523184 predicted 520
7 SASI_Hs02_00523185 predicted 272
8 SASI_Hs02_00523186 predicted 276
9 SASI_Hs02_00523187 predicted 506
10 SASI_Hs02_00523188 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523189 predicted 478
2 SASI_Hs02_00523190 predicted 265
3 SASI_Hs02_00523191 predicted 326
4 SASI_Hs02_00523192 predicted 272
5 SASI_Hs02_00523193 predicted 510
6 SASI_Hs02_00523194 predicted 517
7 SASI_Hs02_00523195 predicted 274
8 SASI_Hs02_00523196 predicted 277
9 SASI_Hs02_00523197 predicted 506
10 SASI_Hs02_00523198 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523199 predicted 471
2 SASI_Hs02_00523200 predicted 264
3 SASI_Hs02_00523201 predicted 323
4 SASI_Hs02_00523202 predicted 276
5 SASI_Hs02_00523203 predicted 513
6 SASI_Hs02_00523204 predicted 523
7 SASI_Hs02_00523205 predicted 276
8 SASI_Hs02_00523206 predicted 278
9 SASI_Hs02_00523207 predicted 507
10 SASI_Hs02_00523208 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153709
LINC00337 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 337
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-730s1c1
Sequence:CCGGGCTTCTGCTCTCCTCAATGTACTCGAGTACATTGAGGAGAGCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1037s1c1
Sequence:CCGGGAAGCAGATCTAAGCACACATCTCGAGATGTGTGCTTAGATCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1025s1c1
Sequence:CCGGGAGAAAGGAGAGGAAGCAGATCTCGAGATCTGCTTCCTCTCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-731s1c1
Sequence:CCGGCTTCTGCTCTCCTCAATGTATCTCGAGATACATTGAGGAGAGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1060s1c1
Sequence:CCGGGCATCAAACCAGAGGAACAAACTCGAGTTTGTTCCTCTGGTTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153709
LINC00337 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 337
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-730s1c1
Sequence:CCGGGCTTCTGCTCTCCTCAATGTACTCGAGTACATTGAGGAGAGCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1037s1c1
Sequence:CCGGGAAGCAGATCTAAGCACACATCTCGAGATGTGTGCTTAGATCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1025s1c1
Sequence:CCGGGAGAAAGGAGAGGAAGCAGATCTCGAGATCTGCTTCCTCTCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-731s1c1
Sequence:CCGGCTTCTGCTCTCCTCAATGTATCTCGAGATACATTGAGGAGAGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1060s1c1
Sequence:CCGGGCATCAAACCAGAGGAACAAACTCGAGTTTGTTCCTCTGGTTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153709
LINC00337 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 337
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-730s1c1
Sequence:CCGGGCTTCTGCTCTCCTCAATGTACTCGAGTACATTGAGGAGAGCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1037s1c1
Sequence:CCGGGAAGCAGATCTAAGCACACATCTCGAGATGTGTGCTTAGATCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1025s1c1
Sequence:CCGGGAGAAAGGAGAGGAAGCAGATCTCGAGATCTGCTTCCTCTCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153709.1-731s1c1
Sequence:CCGGCTTCTGCTCTCCTCAATGTATCTCGAGATACATTGAGGAGAGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153709.1-1060s1c1
Sequence:CCGGGCATCAAACCAGAGGAACAAACTCGAGTTTGTTCCTCTGGTTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)