EMAIL THIS PAGE TO A FRIEND

LINC00341

long intergenic non-protein coding RNA 341

81 Gene Product Result for
Synonyms: C14orf139 NCRNA00341
Species: Human LINC00341(79686)
UniProtKB ID: Q9H761, Q6IA18
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024633 Rosetta Predictions human pricing
XR_017975 Rosetta Predictions human pricing
XR_040801 Rosetta Predictions human pricing
XR_040802 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154381 predicted 1415
2 SASI_Hs01_00154382 predicted 1299
3 SASI_Hs01_00154383 predicted 1403
4 SASI_Hs01_00154384 predicted 1253
5 SASI_Hs01_00154385 predicted 458
6 SASI_Hs01_00154386 predicted 1311
7 SASI_Hs01_00154387 predicted 1405
8 SASI_Hs01_00154388 predicted 1435
9 SASI_Hs01_00154389 predicted 1425
10 SASI_Hs01_00154390 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495137 predicted 566
2 SASI_Hs02_00495138 predicted 644
3 SASI_Hs02_00495139 predicted 674
4 SASI_Hs02_00495140 predicted 797
5 SASI_Hs02_00495141 predicted 777
6 SASI_Hs02_00495142 predicted 926
7 SASI_Hs02_00495143 predicted 556
8 SASI_Hs02_00495144 predicted 815
9 SASI_Hs02_00495145 predicted 913
10 SASI_Hs02_00495146 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522071 predicted 557
2 SASI_Hs02_00522072 predicted 647
3 SASI_Hs02_00522073 predicted 666
4 SASI_Hs02_00522074 predicted 801
5 SASI_Hs02_00522075 predicted 774
6 SASI_Hs02_00522076 predicted 924
7 SASI_Hs02_00522077 predicted 557
8 SASI_Hs02_00522078 predicted 814
9 SASI_Hs02_00522079 predicted 913
10 SASI_Hs02_00522080 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522081 predicted 566
2 SASI_Hs02_00522082 predicted 642
3 SASI_Hs02_00522083 predicted 668
4 SASI_Hs02_00522084 predicted 800
5 SASI_Hs02_00522085 predicted 777
6 SASI_Hs02_00522086 predicted 924
7 SASI_Hs02_00522087 predicted 555
8 SASI_Hs02_00522088 predicted 816
9 SASI_Hs02_00522089 predicted 910
10 SASI_Hs02_00522090 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024633
LINC00341 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 341
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000136517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-625s1c1
Sequence:CCGGCTTTCTGAAACGCTTGCTTCTCTCGAGAGAAGCAAGCGTTTCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-884s1c1
Sequence:CCGGGTGGTAAATTTGGGACTTGTACTCGAGTACAAGTCCCAAATTTACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-2644s1c1
Sequence:CCGGCGGAGTTTCTTCTTAGTGCTACTCGAGTAGCACTAAGAAGAAACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-1586s1c1
Sequence:CCGGCCTGGCATTCTCCATAAAGAACTCGAGTTCTTTATGGAGAATGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024633
LINC00341 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 341
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000136517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-625s1c1
Sequence:CCGGCTTTCTGAAACGCTTGCTTCTCTCGAGAGAAGCAAGCGTTTCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-884s1c1
Sequence:CCGGGTGGTAAATTTGGGACTTGTACTCGAGTACAAGTCCCAAATTTACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-2644s1c1
Sequence:CCGGCGGAGTTTCTTCTTAGTGCTACTCGAGTAGCACTAAGAAGAAACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-1586s1c1
Sequence:CCGGCCTGGCATTCTCCATAAAGAACTCGAGTTCTTTATGGAGAATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024633
LINC00341 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 341
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000136517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-625s1c1
Sequence:CCGGCTTTCTGAAACGCTTGCTTCTCTCGAGAGAAGCAAGCGTTTCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024633.2-884s1c1
Sequence:CCGGGTGGTAAATTTGGGACTTGTACTCGAGTACAAGTCCCAAATTTACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-2644s1c1
Sequence:CCGGCGGAGTTTCTTCTTAGTGCTACTCGAGTAGCACTAAGAAGAAACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024633.2-1586s1c1
Sequence:CCGGCCTGGCATTCTCCATAAAGAACTCGAGTTCTTTATGGAGAATGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)