EMAIL THIS PAGE TO A FRIEND

LINC00342

long intergenic non-protein coding RNA 342

Gene Product Result for
Synonyms: NCRNA00342
Species: Human LINC00342(150759)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175853
LINC00342 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 342
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175853.2-356s1c1
Sequence:CCGGCATGATGGATTCCCAGCCATACTCGAGTATGGCTGGGAATCCATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-959s1c1
Sequence:CCGGGCTTGGCTATTAGGGCTCTTTCTCGAGAAAGAGCCCTAATAGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-681s1c1
Sequence:CCGGGCCTCAACATACACGTCAATTCTCGAGAATTGACGTGTATGTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-265s1c1
Sequence:CCGGCCAGGAAGAAATTGATTTGCTCTCGAGAGCAAATCAATTTCTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-223s1c1
Sequence:CCGGGATGGATAAATTCCTGGACAACTCGAGTTGTCCAGGAATTTATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-172s1c1
Sequence:CCGGCAGAAACTACTGCAAACACTTCTCGAGAAGTGTTTGCAGTAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1682s1c1
Sequence:CCGGGCAGACAGAATCAATAGAGTTCTCGAGAACTCTATTGATTCTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-150s1c1
Sequence:CCGGCCACAGAAATAGAAACAACCACTCGAGTGGTTGTTTCTATTTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1581s1c1
Sequence:CCGGCCAGTGTTGTTGTTACCTGAACTCGAGTTCAGGTAACAACAACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175853
LINC00342 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 342
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175853.2-356s1c1
Sequence:CCGGCATGATGGATTCCCAGCCATACTCGAGTATGGCTGGGAATCCATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-959s1c1
Sequence:CCGGGCTTGGCTATTAGGGCTCTTTCTCGAGAAAGAGCCCTAATAGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-681s1c1
Sequence:CCGGGCCTCAACATACACGTCAATTCTCGAGAATTGACGTGTATGTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-265s1c1
Sequence:CCGGCCAGGAAGAAATTGATTTGCTCTCGAGAGCAAATCAATTTCTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-223s1c1
Sequence:CCGGGATGGATAAATTCCTGGACAACTCGAGTTGTCCAGGAATTTATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-172s1c1
Sequence:CCGGCAGAAACTACTGCAAACACTTCTCGAGAAGTGTTTGCAGTAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1682s1c1
Sequence:CCGGGCAGACAGAATCAATAGAGTTCTCGAGAACTCTATTGATTCTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-150s1c1
Sequence:CCGGCCACAGAAATAGAAACAACCACTCGAGTGGTTGTTTCTATTTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1581s1c1
Sequence:CCGGCCAGTGTTGTTGTTACCTGAACTCGAGTTCAGGTAACAACAACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175853
LINC00342 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 342
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175853.2-356s1c1
Sequence:CCGGCATGATGGATTCCCAGCCATACTCGAGTATGGCTGGGAATCCATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-959s1c1
Sequence:CCGGGCTTGGCTATTAGGGCTCTTTCTCGAGAAAGAGCCCTAATAGCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-681s1c1
Sequence:CCGGGCCTCAACATACACGTCAATTCTCGAGAATTGACGTGTATGTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-265s1c1
Sequence:CCGGCCAGGAAGAAATTGATTTGCTCTCGAGAGCAAATCAATTTCTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-223s1c1
Sequence:CCGGGATGGATAAATTCCTGGACAACTCGAGTTGTCCAGGAATTTATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-172s1c1
Sequence:CCGGCAGAAACTACTGCAAACACTTCTCGAGAAGTGTTTGCAGTAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1682s1c1
Sequence:CCGGGCAGACAGAATCAATAGAGTTCTCGAGAACTCTATTGATTCTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175853.2-150s1c1
Sequence:CCGGCCACAGAAATAGAAACAACCACTCGAGTGGTTGTTTCTATTTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175853.2-1581s1c1
Sequence:CCGGCCAGTGTTGTTGTTACCTGAACTCGAGTTCAGGTAACAACAACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)