EMAIL THIS PAGE TO A FRIEND

LINC00346

long intergenic non-protein coding RNA 346

44 Gene Product Result for
Synonyms: C13orf29 NCRNA00346
Species: Human LINC00346(283487)
UniProtKB ID: Q8IVM7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178514 Rosetta Predictions human pricing
XR_041485 Rosetta Predictions human pricing
XR_041486 Rosetta Predictions human pricing
XR_041487 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220076 predicted 588
2 SASI_Hs01_00220077 predicted 905
3 SASI_Hs01_00220078 predicted 1375
4 SASI_Hs01_00220079 predicted 764
5 SASI_Hs01_00220080 predicted 1309
6 SASI_Hs01_00220081 predicted 884
7 SASI_Hs01_00220082 predicted 634
8 SASI_Hs01_00220083 predicted 1444
9 SASI_Hs01_00220084 predicted 1383
10 SASI_Hs01_00220085 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527761 predicted 208
2 SASI_Hs02_00527762 predicted 217
3 SASI_Hs02_00527763 predicted 288
4 SASI_Hs02_00527764 predicted 197
5 SASI_Hs02_00527765 predicted 216
6 SASI_Hs02_00527766 predicted 207
7 SASI_Hs02_00527767 predicted 290
8 SASI_Hs02_00527768 predicted 293
9 SASI_Hs02_00527769 predicted 438
10 SASI_Hs02_00527770 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527771 predicted 538
2 SASI_Hs02_00527772 predicted 375
3 SASI_Hs02_00527773 predicted 430
4 SASI_Hs02_00527774 predicted 487
5 SASI_Hs02_00527775 predicted 585
6 SASI_Hs02_00527776 predicted 654
7 SASI_Hs02_00527777 predicted 434
8 SASI_Hs02_00527778 predicted 543
9 SASI_Hs02_00527779 predicted 363
10 SASI_Hs02_00527780 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527781 predicted 534
2 SASI_Hs02_00527782 predicted 374
3 SASI_Hs02_00527783 predicted 428
4 SASI_Hs02_00527784 predicted 492
5 SASI_Hs02_00527785 predicted 585
6 SASI_Hs02_00527786 predicted 659
7 SASI_Hs02_00527787 predicted 439
8 SASI_Hs02_00527788 predicted 545
9 SASI_Hs02_00527789 predicted 367
10 SASI_Hs02_00527790 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178514
LINC00346 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 346
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-584s1c1
Sequence:CCGGCTGTCCTTACGAGGCATGTTTCTCGAGAAACATGCCTCGTAAGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-681s1c1
Sequence:CCGGCAAGCGGAAGGAAGTGTGTTTCTCGAGAAACACACTTCCTTCCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-766s1c1
Sequence:CCGGGACATTCATGGACTTTCGTTTCTCGAGAAACGAAAGTCCATGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-588s1c1
Sequence:CCGGCCTTACGAGGCATGTTTCCTTCTCGAGAAGGAAACATGCCTCGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178514.3-1640s1c1
Sequence:CCGGGCTCACTACAACCTCCACTTTCTCGAGAAAGTGGAGGTTGTAGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-589s1c1
Sequence:CCGGCTTACGAGGCATGTTTCCTTTCTCGAGAAAGGAAACATGCCTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178514
LINC00346 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 346
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-584s1c1
Sequence:CCGGCTGTCCTTACGAGGCATGTTTCTCGAGAAACATGCCTCGTAAGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-681s1c1
Sequence:CCGGCAAGCGGAAGGAAGTGTGTTTCTCGAGAAACACACTTCCTTCCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-766s1c1
Sequence:CCGGGACATTCATGGACTTTCGTTTCTCGAGAAACGAAAGTCCATGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-588s1c1
Sequence:CCGGCCTTACGAGGCATGTTTCCTTCTCGAGAAGGAAACATGCCTCGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178514.3-1640s1c1
Sequence:CCGGGCTCACTACAACCTCCACTTTCTCGAGAAAGTGGAGGTTGTAGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-589s1c1
Sequence:CCGGCTTACGAGGCATGTTTCCTTTCTCGAGAAAGGAAACATGCCTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178514
LINC00346 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 346
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-584s1c1
Sequence:CCGGCTGTCCTTACGAGGCATGTTTCTCGAGAAACATGCCTCGTAAGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-681s1c1
Sequence:CCGGCAAGCGGAAGGAAGTGTGTTTCTCGAGAAACACACTTCCTTCCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-766s1c1
Sequence:CCGGGACATTCATGGACTTTCGTTTCTCGAGAAACGAAAGTCCATGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-588s1c1
Sequence:CCGGCCTTACGAGGCATGTTTCCTTCTCGAGAAGGAAACATGCCTCGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178514.3-1640s1c1
Sequence:CCGGGCTCACTACAACCTCCACTTTCTCGAGAAAGTGGAGGTTGTAGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178514.3-589s1c1
Sequence:CCGGCTTACGAGGCATGTTTCCTTTCTCGAGAAAGGAAACATGCCTCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)